Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19102  (registered. 2012)
Contig Information
Length 1590 bp
Clones alternative view 38 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|24496452|gb|AAN59956.1|| actin [Hordeum vulgare]
Score 758
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig19102
CGGCAGAGGGAGGGAGGGAGGGAGGACAGTCCAGAGCGGCAGCAGTTATAGCCACCACCTCCCCCCTCCTCCTCCGATCGCATCTCCCCTCCTCCCGTCG
CCCGCCTCGGCCTCCTCCGACCGAGCTCGCTCGCTCTCCACGATATTCTGTAGGAAATGGCTGACGGTGAGGACATCCAGCCCCTTGTTTGCGACAATGG
AACCGGAATGGTCAAGGCTGGTTTCGCTGGAGATGATGCACCAAGGGCTGTTTTCCCTAGCATAGTTGGTCGCCCACGGCACACTGGTGTCATGGTAGGG
ATGGGGCAGAAGGATGCTTATGTTGGTGATGAGGCGCAGTCCAAGAGAGGTATCCTCACACTCAAGTACCCGATTGAGCACGGTATCGTAAGCAACTGGG
ATGACATGGAGAAAATCTGGCATCACACTTTCTACAATGAGCTCCGTGTGGCACCTGAGGAGCACCCTGTGTTGCTCACTGAGGCTCCTTTGAACCCAAA
AGCCAACAGAGAGAAGATGACCCAGATTATGTTTGAGACTTTCAATGTTCCTGCCATGTACGTCGCAATTCAGGCCGTGCTTTCCCTCTATGCAAGTGGT
CGTACTACTGGTATCGTTCTCGACTCTGGTGATGGTGTCAGCCACACCGTGCCCATTTACGAAGGATACGCGCTTCCTCATGCCATTCTTCGTTTGGATC
TCGCTGGTCGGGATCTCACGGACTCCCTCATGAAGATCCTCACCGAGAGAGGTTACTCCTTCACAACCTCAGCCGAGCGGGAAATTGTAAGGGACATCAA
GGAGAAGCTTGCGTATGTTGCCCTTGATTATGAACAGGAGCTGGAGACTGCCAAGAACAGCTCCTCAGTTGAGAAGAGCTACGAGCTTCCTGATGGTCAG
GTCATCACGATTGGCGCAGAGAGGTTCAGGTGCCCTGAGGTCCTCTTCCAGCCATCCATGATCGGCATGGAGTCTTCTGGAATCCATGAGACGACCTACA
ACTCCATCATGAAGTGTGACGTGGATATCAGGAAGGACCTGTACGGCAACATTGTGCTCAGTGGTGGCACAACTATGTTCCCAGGTATCGCTGACCGTAT
GAGCAAGGAGATCACCGCGCTTGCTCCGAGCAGCATGAAGATCAAGGTTGTCGCCCCACCTGAGAGGAAGTACAGTGTCTGGATCGGAGGGTCCATCCTA
GCCTCACTCAGCACTTTCCAACAGATGTGGATATCCAAGGATGAGTACGACGAGTCTGGCCCGGCTATCGTCCACAGGAAGTGCTTCTGATCTCCGGGAG
CGCTCCGCCTCCGCCGCCGTTATCATCTAGTCTCGGGTTATGTTTGGTTCATTCTTCTAGAAATGTATTGCGTATTTGCAAGCTATGTTTTTTTCCAGAC
GTGACGTGAGTACTCTTGGGATATGCTACCTATATACGTGGCGGCTCCATGGTGCAAGTGCAAGTACACTATATCTATGTTTGTGTATTGTCACAGTGTG
TTTGTGAGATCAGTTGTCAAACTTGGGTTGGCTTGATTTGTTGTTGGAGTTGTCTGTAATAGCTCATGGTTTTTGCTATGTATTTTTTAT
page-top