Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig19096  (registered. 2012)
Contig Information
Length 560 bp
Clones alternative view 124 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_VSCB Liquid cultured tissue 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 9
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 23
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 11
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 12
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 21
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig19096
TTTTTTTTTTTTTATGAAACGGATTTCACTCCGCTAAAGTATTTTTTTTTTATTAGACAATATAAACAGGGCCAGATAATATTAACGATGCTTATTACAA
CTTACAACAAAATAACATACATAACACATCCACACATGATACATTTCCGCGAAACACCAACAATACTTATTTTTCTTCACAACATGCCCATGCTTATTTG
TTCGGCAAATTAACTGGACGATGTTGAGACCTGCATGGGCTTTTATTCCAGTAGGCTAATTACAAGCTAGCTTAGCCAATCTTGGGAACCTCCGCCACTG
TGTCGACCCAGACGCGGACGCGGTTCAGATCGACCTCCTGTGTCACAACACTTCCTACCGGGACAATGACAACTTTGAGGTCCGGTCGGTCCGCCTTGAT
CTTCTCCTCCGCCTCCTTGATCGTGCGCCCGACCAGCTCAGGCCACTCCGTCTTGGCACCGTCGCATGGCTTGCTCATGTTGGAAACGAAATTGGGCAAA
CGCCACGAGCTCTATGCACTTCTATGTGATTTGATCGTTTCTAGCACCGGCTTGCCCCGG
page-top