Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18936  (registered. 2012)
Contig Information
Length 812 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110224485|emb|CAJ53899.1|| transcription factor MybS3 [Hordeum vulgare subsp. vulgare]
Score 359
Evalue 2.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18936
AACTGACTGATATTTCTTTTTCTTATATAAGAGTTTGCAGTACAACCCTGGAGATCAGCACTAACATTAATGATTCTGTCAACATGCACTGGCATATCAT
GTACCATACAAACAACAGATGCATCCATACATAACATAACTTACAACACAGGGTACATTGGACAGACTACAGACCACAGTTAATCTTAAAAAGAAAAGAA
AAGGAAAAGAGGCAAAGCTTATTTTTGCCAGGGCTCATCTAAGTGCAGTTTGTGTGCTGAGGGGGCTCACGCCTGAGCCCTCGTTGGGAGATTCGCCTGG
AAAGCCGATTGTCTATTTTGACCTCCTACCATTTTTAAGGAAAGAGAGGTAGATACTGTATCTTGCTTGGGATCCCCTATGCTTAGCTTCGACATGCCCA
CCAGTTCATCAACATTGATTGGACTCTTTGAATGAACCGGAACAGGCTTAACAATCTCATGTGTTCCTTGTCCAAGATCATCTCCATCATTCTGATTTTG
CCAGAAAGGAACTGAGAATTGCAAGAATGGTGAGAAATATGCTGGAACTAGCACCGGATAGCTCGACTGCAAATTCTCAGGCATGATAGCAGAAGCTGAA
GAACTCTCTGCAATGACAGAAGTATCTGACTCCATAGATTCTACCTCCTCCTCCTCCATGGGTGGAGGTAATGGTGGGTGATTTAATATCTGGGCCTCAG
GTTCTTGATTACCAGGTAGGGGTGGCAGGTCTGACTCATCAGGCACCAAGTCAAAGAGGCTAGACCTTCTCTTCCTTCTGCTCATATTGGCTTGGCGTAT
AAAATATTTCTG
page-top