Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18913  (registered. 2012)
Contig Information
Length 801 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226503485|ref|NP_001148687.1|| 26S proteasome non-ATPase regulatory subunit 6 [Zea mays]
Score 381
Evalue 5.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18913
GTTCATCACAGAAGAAAGATCCTTCAGCCTGATCTTCTGGGATATGAGTTCATAGTAATTCATACAAGACTTCCTCCTCCGCACGCTCAACAAAGCCAGG
CACTGGTCATATACTCTAGGAGGCTAGCTGGAATAGGTCCAACAACCGGGCACAACCTTTGCTGGGCCAGAGCTCCCCAACAAGAACAGCAACTTTTACA
GATCAATGACTCGGGATAGCTTCTGGATGCGGTTTAGCAAGAAGTCCCCTTGCTTGATGGTCGACTGGTAGAAAGCATTCCTCTCATCAGGCCGGTTTGT
CTCCAGAACACCAGCGACCTTGTCAATCTTGCAGTGAAGCTTCCCAGCTGCAATAAAGCGAGAAAGTTCCTGGTCTATGAAATCAACAGTCACACCAAAT
GCAGAAGCCATAGCTTCCATCGTCACACTCTTGTATGACTCCAAAAACTGTGAGTAGACAACAGTGCGCACTTCCCTCATGTAGTAGCGGAAATGAGGTT
GAAGATAACGGTCTAACTTGATCTGTTCCGTCAAGCCAGAGAATGCAACAAAAAATGACTTGTACTGGCAATTGTACAGAGAGTTGAGAAACTCTGAGAG
GTGTGGTACTTTGCTAATCACTGCAAGGATTTCTGGTGCATCCACCACCTTTTGTTTTAGAGATACACGATCCAATGAGATGATACTTGTGAGGACTGTA
TAGAAGATGAAAGTGTCATATGGAAACAACTCATNNNNTGTGAAAGTTGAGATGGAGTCCAAAAACAGGCTGGTAGCTTTCTTGAAGTTTCTGGTTGCCA
T
page-top