Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18912  (registered. 2012)
Contig Information
Length 2030 bp
Clones alternative view 303 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VHS Shoot with heat shock treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 22
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 19
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 51
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 27
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 15
WH_XF Seedling, infected with leaf rust 30
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 46
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 50
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 9
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 10
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|193074381|gb|ACF08096.1|| class III peroxidase [Triticum aestivum]
Score 608
Evalue 8.00E-172
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18912
TTTTTTTTTTGAAGCAGCAATAATTCATATAGTATAGAAGTCAACAAGTAACTGACGCAAGGGAAACCTTCATGCCTTTGCACGAGGCCCTTGACATACA
TGTATGACACATCTCCTGTTTTCATAAGCTTATGGTCCAAGAAAGGGCGCCCAAGTACACTTTGGATGTTGTATAATGGCCATTGCTAGCCTTATTAATC
TCACATATATGACCATTTTTTAGCAATTAATTCACCTTTGAGCAGCTGAGCCTGACCTGCCCCTGAGAGCCAGTCAATGGGCTGAGGTTCCCCATCTTCA
CCATGGCTGAGGCGAAGGCGCTGCTGAACGCCGCTGGGTTGCTTGCGAAGTTGTTGACCGTGTTGTCGGTGCCGCCGCCGGTGCCGGTGAAGAGCACCTG
GTCGGAGTGCAGGAGACCCTTCTGGGACTTGAGGTTGCTGTAGTAGGCGTTGTCGAAGGAGTACGGGGTCGACACGTCCAGATTGGCCAGGTTGCGGTCG
CCGGAGCCAGTCGGCTGGGGGCAGTTGGCCTTGAGCGACGTCGCGAAGCCGGAGTTGATGTTGGTCTCGTTGTAGAGTCTGTCCCTGAAGTTCTGGCACT
GAGCCTGCCCGATGGTGTGGGCGCCCGAGAGGGCGACCATGTCGGTCACGGTGAAGCCTTTGTCGCCGAAGGATTGGGTGAGGTTAACGAGGTCGAAGAA
TGGGGGAGGTAGGTCGGAGTTTGCCGCGGCTTCGTTTGCATTGGTGGAGTCCCTCCTTCCAAGAGGAACCGTCCACGAAGGCCCTCCTAAGGCGACGACA
GAGTCGCGGGCAGCGACGGTGAGGATGTCGGCGCAGGAGACGGTCTGCTTGCACATGGTCTCGAGCTTTGCCTTGATGTTGTCGATGACTTCGAAGCCTC
GCAGCGACATCACGTTCGGGAAAGCGTTTTGTTCCATGCCAGACAGCAGAACAGACGCGTCACAACCTTGGACGAAGCAGTCGTGGAAGTGCAGCCGGAG
CAGCGACGCGCCCATGCGGTTCTCCTTGTTGACGGCAGCCGTCACGGCGGCCTTGATAGTGGACAGAGCGTTCGGGCACGACGTTTGGTAGAACGTCGGC
GACAACTGCGCCGACGCCGCCATGGCCAGGCACAAGAGCAACACGGTTGATAGAGACGAATGGGCCATGGCTTCTTGCTAGCCAACGTCTAGTGAGAGAC
ACTAGCTTAATTGTGATAGGAAGAACGGAGGAAACCTTGGGTTTTCGGGGCATTGGATTCTCACCAATGTTTTCGTTACTCAAGCCGACATTCTCGCTTC
CGCTTCGTCGACCCCCGCTTTCGCGGTTGCTTCCCTCTAAGGCGGAACGCTCCCCTACCGATGCATTTTGACATCCCACAGCTTCGGCAGATCGCTTAGC
CCCGTTCATCTTCAGCGCAAGGGCGCTCGATCAGTGAGCTATTACGCACTCTTTAAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTTTGCACCC
CCACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCATCGTCTCACTGGC
CGACCTTGACCCCTGTTATTTTTGGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCGCGCAGCCCGCACCGAAACAGTGCTTTACCCC
TAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTG
ATTCTTCAACATCAGTCGGTTCGGACCTCTGCTTAGTTTCATCCAAGCTTCATCCTGGTCATGGATAGATCACCCAGGTTCGGGTCCATAAGCAGTGACA
ATCGCCCTATTAAGACTCGCTTTCGCTACGGCTCCGGTGGGTTCCGTTCCCTTAACCAAGCCACTGCCTATGAGTCGCCGGCTCATTCTTCAACAGGCAC
GCGGTCAGAGATCACTTTCCCCTCCCACTG
page-top