Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18896  (registered. 2012)
Contig Information
Length 1720 bp
Clones alternative view 141 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 2
Wh_h Spike at heading date 5
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 15
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 11
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 16
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 15
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 8
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115468934|ref|NP_001058066.1|| Os06g0612800 [Oryza sativa (japonica cultivar-group)]
Score 292
Evalue 1.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18896
TCACAGCAGAATTCCACCAACATCTCACCTGACACTGAACTTCTATCTTCTGGTGGAGATAGCACAGCTGCACAGGTCAGGTGTGATGTAAATTTTCTCA
GGGGCTAACTGCTCTGAAGATCAGGAAGACAGGAACTATTGACAAGGGGGGATCACCATGGGTACCATAATAACAGACGACGACGCTTACTCGATACCAT
TACCGGTTGCGACTGTAAGACAGACAGACAGACACCGGGAGGAAACAGCAGTACATTACAGAGTGCTAGCCAAAATGCGAAAGCCACAATACCGTTCCCG
TTCCGCCGCGCAGAGAGACGACCATAAATAAAGCTTACACAACATAGCCAACAAGGAGACCGTTCGGACCTGGGGCTGCCGCCGAGGCGCGTGTGCCATG
CATCACGATTGCCCAACAACTAAGATTGCAGAAGCCAACATGATGAAAGGATAATGCAGCAAGACGCACGATGACGAGGTAGCGCAGATTTGATTTGGGA
CCTTATGTTCTGCCGACCGTAGGGGGGACCCTTCCTAGATCTTGTCAAGCTTCTCCGCCTTCACCACTGGGTTGGCCTTGGCGATGGCGTCCATGGCCGC
GGCGCGGTAGTCAAACTTGCACTCGTGCTTGTCCGAGTAACGGTGCGTTGCGCAGTACAGGTTCCCACACCGGCAGTTGAATCCGGTCAGCCCGACCCTC
TTTCTGCAGGTGCTGCACCGGCTTGGGCCTTTGGGGTTCTCCATCGCCCCCTCGCTTGGACCAGCGATATCAGCAGGCTGTGCGGTAATAAGCGTCTTCG
CCTCAACGTGAGCAACTGCCACCGCCGTGCTGCCAGCAGCAAGATGTTCTTTCGCGGCATCGCCACCGTTGACGATGCTGTCGAAAGAGGAGGCGGCCAG
CTTTGCCTGCTCCTGCTTCATCGCCATCTCCTTGTGGCACTTGGAGCACATGTTCATGGTCGCCGCGCTGCCGAAGAAGCCACAATTATTGACGCAAAGG
ATGGGGCCCTCCCGAGACTGGCAGCCGGTCTCCTTGTGCTCCATGGCTTTGATTTAACTGATAGGAGGAAGCCCTCGTCGCGATTCCTCTCCGGCGATCC
CCTAGGAGGGGGAGGACGAGGAGGCGAGGGGAGAGGAATCGCGAGGAATTCGGTGGGCTACGGTTAAGGGTAATGACTTCAAACATGGCCAGCTCCTATA
GTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTCCTGCTTCATGCAGGCGAGTTGCAGC
CTGCAATCCGAACTGAGGACGGGTTTTTGGAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCCCATTGTAGCACGTGTGTCGCCCAGGGCAT
AAGGGGCATGATGACTTGGCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAGTGGCAACTAAACACGAGGGT
TGCGCTCGTTGCGAGACTTAACCCAACACCTTACGGCACGAGCTGACGACAGCCATGCACCACCTGTGTCCGCGTTCCCGAGGGCACCCCTCTCTTTCAA
GCCACCTCGATCGAGAGAAGCTCGGATCCCCGGAGGAGAGCAGAGGAGAGGAGCCCACTTTAGCTCTCGGTTGCGCCGCGGCGATGGGGAGCCTACGAGG
CGGAAGCGGCGGAGAGGGAA
page-top