Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18861  (registered. 2012)
Contig Information
Length 921 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222625905|gb|EEE60037.1|| hypothetical protein OsJ_12809 [Oryza sativa Japonica Group]
Score 415
Evalue 3.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18861
TTTTTTTTTTAGCAAACGGAAAACATCACTTTTATTGTTACAGCCATTTATTACGGTGTCCAAAAGTTTTCAGCCATGGCGATGGTGGAAAGACGATGAT
GTTACAACCATCCTAGCGGTAGATCGATAGGGGGAACAGCCCCGCCCACGCGGACGAGCTGGGAGGCTGCTCTCAAACACTATCAGGTGACCCCCTGCCA
ACCTTGGATGGAACACGCAGAGAACCGGTTCGACGGTCCTCGATTCAAGCTGGTGCTAGAACGATTTCTTCTCGTAAGACACCAGCCCGTGGATCCCTCC
CTCCACTTGGGCGGCACCGGTCCTCACCTCTAATCTAAGAGTCTCCGCTCGTAAAAGATCATGAGCTGACTGCAAAGAGGATGCACCAAGATCTTGGAAT
CCTTGCTTAACAGCTTGCATTGTATACGGAATAAACCTCAGAACAGAACCTTTGTCAGCTACCGCTCCAACAACTCCCTGGGCAACTTTAAGCTTCAGAG
TATCACCAAGATACCTTGCATCGCTCCCCTTTGTCATGGCTTCGAGGGAGCCCATACCTCTGTATTTTTTTACTCGGTGGCCGTCCTTGTATTCATAGGC
CCCAGGAGCCTCATGGCTGCCAGCCAAGAAACTGCCCATCATAACAGTTGATGCGCCCAGTGACAAAGCCTTCACAATATGGCCAGAGTATGAAATACCA
CCATCAGCTATAACTGGCACATTATGATCCTTGGCATATGACGCAACCTTGTAAACAGCAGTGGCCTGTCCTCTACCCACAGCGCAAACTTCCTGGGTAG
TGCAAATTGAACCAGAGCCCATTCCAACGCGCAGGCCATCCACTCCAGCAGCAATCAAATTCTGTGCCTGCCCAATTGTCACCACATTGCCCCCAATCAA
ATCCACCTCCGGAAACGTCTT
page-top