Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1886  (registered. 2012)
Contig Information
Length 824 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 3
Wh_CSEC Callus 9
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199747|gb|EEC82174.1|| hypothetical protein OsI_26284 [Oryza sativa Indica Group]
Score 234
Evalue 9.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1886
GCAGATACGGTTCAAAACTAGATGTATCGACACCGGCTGGAACAGCGAATGTCAAACNNNAATGGATGATTTTTTTTTTACCACGCTTAACAAAGCATAT
ATTATTCAACCTTGATGGGAGAGGGTAACAAGCCATCTAAAGATGGTGCTCCTTACAAAGTTTCAACACAACGGTAACAAGCATACACGCAGAGAGGTGG
GCTATGCTAGATTTTCTGTATACTCAGAGCGCGCAAGCTGGTAACGCCTGCTAGCGCTAGCACACAACTAAATATACTGCACCACCAATATATAGCTGCT
TTGCATGTAGACTCTGATATGGAGCTGGCAGTTGCTCAGAAACCATGAATCTTGATGTGTTCCTTCTTCACAATGCCGGCCTGGACAAGGAAGTTTGAGA
CGTTCTTCCTCTGATCACCCTGGAGTTGAATGACCTGTCCAAGTTCTGTGTCCTGGACAACTGTACCATTGCAGCAAAACTCTTTCTTGAGGTCTTTGAG
GATCTTGCTGTAGCTGAACTCCTTCTTCAGACCCTGGACAGTGGTCAGGCTCTTGCGACCATTACGCTGCTGGATGCGTACATGAACGTAGTCTTTTGAT
CCGGCAGCTGCACCAGCGTCCCCAGCATTCGCCTCGGCAAAGGGGTCAAAGGCAGTTGGGATCTGAACGTCAAGATCAGACATGAAATCTCCTGCTGAGA
CTGGCAAAAGCCTGGGAGGCGGTCGAGGAGGAAGAGATCAACCAAGATCTTTCCCGGGAGGATTTGGATCGCGGAGAGGCGCTGGTAGTGAGTCCTTGGT
GTTCTTCCTCCTCTTTGGGTTTGA
page-top