Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18822  (registered. 2012)
Contig Information
Length 1542 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_SH - 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_F/WH_R 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222635257|gb|EEE65389.1|| hypothetical protein OsJ_20711 [Oryza sativa Japonica Group]
Score 681
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18822
AGATGGCGGGTTTATAATGGGAACATGCCAAAACCAAAGTTCTAATGATTATGCTGGATTCACAAGGTAACCTAATAGCATTTTTTTCCAGTTTCCTGCA
TAATCAGGAATTTCTGTTGCACCAATTTAAGTATTGAGTGTGTGGGATTGGCAAGAAATCAGACTTCTTAATTTGCTTTCCAGCTTGCACTTCTTAAATT
GCAATGATGATTACATATTTTATCCATACCGTGCCGATACACATGAGCATTGAAATCAATGACCTTATTCCTTTAACATAGTACTGATACATGAGGTAGA
TGATCTGATGGGGTGGGGATTCATTCCTGAAAGGCCCATCTAGACATCGGACGGCAGAAATGGGTAATCAGTGTATCCAATAACTGGATCAGAGAGGTAG
AAAGTATCTCTTATGTACTTGTTGAGAGGAGCACCTATTTCAAACCTCCGAGGCAAGTCAGGATTGGATAAAAACAAGCGCCCATATGCTACCAAATCAG
CATAGTCATCGGCGATTGCTTTATTTCCATCATCCCTGTCGTATCCCCCAGCTACAATAAATGTTCCTTTAAAAGCATCCCTTATGGGGCGAAGACTATG
GGGAGTTTCAAACTTCTCACCAATATTCACCATCCGTGGTTCCACCATGTGACAATAGAGAATTCCAAATTTGTTTAGTGCATGTGCCATGTATAGGCCT
AGAGCTTCTGGGTTTGAGTCGGATGCCTCTGAATAGTTTGCAAACGGAGAGAGCCTTATCCCAACCTTATCAGCTCCAACTTCATCAACTACAGCTTGAA
CTACTTCCAATGCAAAGCGGCAGCGATTCTCTAAGCTCCCACCATATTTGTCAGTGCGATCATTGACTTGGTCCTTTAAGAACTGATCAATCAAATAACC
ATGAGCTCCATGGATTTCAACACCATCAAATCCGGCTTCAATTGCATTTCTAGCAGCAGCCCTAAAATCGTTGATTACCAAAGGAATCTCATTAGTCTGT
AGCCGCCTAGGAGTTGAAATTGTAGGCACATCTATGCCATTGGCTCTAACTACAGGTTTGAGTGGCTTATCAGTGCTCGAAATTGGAGCCTGCCCGTTAG
GCTGAAAAGTGTGATTGGAGACTCTTCCTACATGCCAAATCTGACAGAAAAATATTCCTCCTTTTGCGTGAACCCCATTCACGATCGGTTTCCATGCTTC
TACTTGCTCCTTTGTCCAAATGCCAGGAGTGTCTTTGTACCCTTGAGCAGTGTCTGAAACTCCAGTGGCCTCAGCAATCAAAAGGCCTCCTTTGGTTGTT
CTCTGTTGATAATACAGTATGGCATGAGGCTGAGGAACATTTCCGAAGGACCGCTCCCTTGTCAGTGGTGCAAGAACTACCCTGTGGGAAAGATCAAACC
TTCCCATCTTGTAGGGGGTGAGGAGGGCAGTCTTGCTCATCTTCCTTGGTCTGCTCCTTGCCCCCTTCCGCCCTTCCTCCGCCCGTTCGTGGGGGTGGGC
CTTTATGTTGATGAAAGCTGTGGCGGCCGGGCGTACTGCTCT
page-top