Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1882  (registered. 2012)
Contig Information
Length 678 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1882
CGCCTAACCCAAACCCTAGCATCGTCCTCGACCTCGACCCCCTCCCTCCCCCGGCCGGCAATCCATGGCGCTGCGCAACCTGGCCGCGAAGTTGCGGATC
CCCACCTCTGCTGCTGCCCGGCTCCCGTCGCCCCCCACCCCTGCTGCTTTCCGGCTCCCATCGGACCCTAGCGTTCCGCCGCCGTCCGTTTCTCGGCTCG
AGAGCGCCAGAGACTGGTACCAGTTCCAGCGGGCACGTTATGATGATGTGACAAGAGAGTTTAGAAACTTCAGGCTTGAGGTTGTGTGGTCTGAAAGGGT
GGCTAACCTGCTTGATTTGGCTTACAAGGTGGGTTGTCCTATTGTCGTTGGTGGTGTGGTCATGAAAGGGATTGCCTATCGGGTGCTTGCCTATCAGAAG
ATGTGATGGGGGTAATGGCCATGTGCTGCTCTGTTCATTAGTGCAGATGCGTGTGCACTTGTGGTGAGCACTCTGGTTGTGGTAACTGGGAACTGCCTGC
AAGAGCAGATAACCATGTAGAAATAAATGGTTTGTTGCGTGCGTGTCTTGATCCGTTGTGTGTCATGGACCAGTGGTTTTGACTTGATGTAATTGTGTCT
AAGCGTACTTCTTCCTGGTAATGGTGTTGGTGCACTTGGTTTGATGAAGAATGGTTTTTTTGAGCCTTGGTTTGATGA
page-top