Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18810  (registered. 2012)
Contig Information
Length 872 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 1
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 3
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|288904218|gb|AAZ67145.2|| geranylgeranyl hydrogenase [Triticum aestivum]
Score 378
Evalue 4.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18810
AACGGAGGGAGTACTACATTCATTCACATATCGAATATTGGCGCGCTTCAACAATCCAGACGAACTGCTCTGAAGTCTGAACATCACCGTGCATGCGTAC
GTTGTAAGTACAAGAAAATCGGACAGGATCGACCAAGACACGACCTCTGGATCGACGCCATTACCTTATTCTCATCTCCTCCGCCTCAAATCCGTTCGAT
CAGCCGCGGATCTCTGCTATACCGATCGATCCGCCGCAGTTTCGAGCGACCCAAGCAGGGTGTCAGGAGCGTTTCCGGCGGGTGAGCGATCACAAGGTGA
GCTTCCCCATCTCCCGGCGCAGCGCGGTGGCCCTGACGAGGCTGCCGATGGTGTTGACGGCGAGCTTGATGTCCTCGATGGGGTTGCCCGGCACGACGCG
CTTGTAGAGGTAGCTGTCGAAGGTCATCCGCTGCACGTAGTCGTCGGCGCACATCTCCACGAACGCCTCCCGCGCCGCGTTGGAGCGGTAGAACACCTTC
TGCAGGATGTCCAGCACTTTGTACGTCGGCCAGTAGAGCCGGTCGAACTCCGCCAGGTACTTGCGCAGGTCGCTCTCGTCCACCAGCCGCGTCCCGTTCG
CCGACCCGGCCACGATCGCCTCCGCGCACATCCGCCCGCTCTTCGCCGCGAAGTAGATCCCCTCGCCGGAGCACTTGGTCACGTACCCCGCCGCGTCGCC
CACCAACGTCACCCGCCCCGACACCCTCTTGGGCCTGGGGTGCTCGGGGATGGGGTGAGCCTCGACGCGGATGATCTTGCCGCCCTCGATCTTGTCCTTG
GCGCNNNNNNGCGTGGCGGCCTGGAACTTCTTGATGTCGGCCTTGTGGGTGACGGTGCCGGTGCCGACGGCG
page-top