Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18690  (registered. 2012)
Contig Information
Length 1598 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|15226521|ref|NP_182239.1|| ARF1A1C; GTP binding / phospholipase activator/ protein binding
Score 352
Evalue 6.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18690
ACAAAATCAGGGCAGGATCTTCATGACTCATCAGGCTCAGGAGCACCTGACATTTTCACTATAGCATAAAGGTTTTCCTCGTGTGTACATTCAATCATTG
ATACAACATAGTAACAGTGTGATAACTGCTCAAAGATAGAGCTTACAAAGACATGTCAACACTCTGGCAGCACTTTAACATGCCTACATATTCCAGTCAT
TTGTCCAGCCGCCAGTTGCTTCTGCGGCTCTGCCAATCCATTGGAAGCTTTCAGGACTTGCTGGCTATATTGTTGGAGAGCCAGTCCAACCCTTCATACA
GACCCTCCCCACTTGTGGCGCAAGCACTCTGAATATACCAGTGTCGCTGACGCAGAGAGTGTAGACCAAGCTTATCTGTTATTTCAGCAGCATTCATGGC
ATTGGGAAGATCTTGCTTGTTAGCAAAAACAAGCAATACAGCATTGCGCAACTCATCCTCATTCAGCATCCTGTGGAGCTCATCTCTTGCCTCAGCAATA
CGGTCTCTGTCGTTGCTGTCGACAACAAAGATAAGGCCCTGAGTGTTCTGGAAGTAGTGCCTCCACAAAGGCCTTATCTTGTCCTGGCCACCAACATCCC
AAACAGTGAAGCTGATGTTCTTATACTCTACTGTCTCCACGTTGAACCCGATGGTGGGGATGGTGGTGACGATCTCGCCGAGCTTGAGCTTGTACAGGAT
GGTGGTCTTCCCGGCGGCGTCGAGGCCGACCATCAGGATCCGCATCTCCTTCTTGGCGAACAGCGCCCCGAACAGCGTCCCGAACGACAGCCCCATCGAT
CTCCCTACCGAACTTCTCCTCCGTCGCCTCCTCCTCTGCTCTCCTCTCCTCTTCTCGCCTCGGATGGAATCGCCCAAAGCACAAGCGAGTTCAAATGAGA
ACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATC
ACGCGCATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATGTGGCGGTTGACGGCGACGTTAGGAAGTCCGGAGACGCCGGCGGGGGCCTC
GGGAAGAGTTATCTTTTCTGCTTAACGGCCTGCCAACCCTGGAAACGGTTCAGCCGGAGGTAGGGTCCAGTGGCCGGAAGAGCACCGCACGTCGCGCGGT
GTCCGGTGCGCCCCCGGCGGCCCATGAAAATCCGGAGGACCGAGTACCGTTCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCC
TCTGGCCAATGGAACAATGTAGGCAAAGGATGACCAGAAGGCCATCGATGCTGAGCTGATCAAGGCTATCGAGGCTGTCCCTGACCTTAAGAACTACCTT
GGTGCCCGGTTCTCTCTCAGGGACGGTGACAAGCCCCATGAGATGACCTTCTAAGTTGCTACAAGTTCCTGAGTTTTGGATGTGTTTTGCCTAGCTTGTT
GCTGAAATTTGAACCCTGTTAGTTGACTTCCTATGTCAGTTGAAGTGANNGTAAAATATTATGAGAAGATCAAGAGTATCCTTATCTGCTTCGGTGGT
page-top