Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1868  (registered. 2012)
Contig Information
Length 1388 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_PCDAM Anther at meiosis 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195622980|gb|ACG33320.1|| salt tolerance protein [Zea mays]
Score 530
Evalue 2.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1868
TCGGCACGAGGCTTTCCTTGGCGACCGACCNNNNNNNAAGGTGAGGTGAGGTGAGGTGGAAGCGAAGCGGCAGGCCAACCCCATCCCTGCACGTGCTCCC
TGCTTCGCTCCACTCGTCACGCTCCAGCTGCCGGCCGGCCCCCCACCAGCACGCGATCTCCACTCGCTCCGTCCGGCCGGATCCCCTTCCTCCCCTCCGC
AGCGAACAGCCATGTCTTCCTCGTCGGACAACCCCAACACGGTCACCGACCGCGGCCTCTTCAGCAAGAGCAGCAAGGACGAGAAGAAGAAGCAGGAGGA
GAAGAAAGAGGAGGAGGAGGGCGGCGGCGGGTTCATCGACAAGGTCAAGGACTTCATCCACGACATCGGCGAGAAGATCGAGGAGGCGGTGGGGTTCGGC
AAGCCGAGCGCGGACGTGGCCCGGATCCACGTGCCCCACATCGGCCTCCACCGCGCCGACCTCGTGGTGGACGTGCTCATCAAGAACCCCAACCCGGTGC
CCATCCCGCTCGTCGACATCGACTACCTCATCGACAGCGACGGCCGGAAGCTGGTGGCGGGCCTCATCCCGGACGCCGGCACCATCCGCGCGCACGGGGA
GGAGACGGTCAAGGTGCCCATCACGCTCGACTTCGACGACATCCGGAGCACCTACGCGGATATCAAGCCCGGGAGCATCATCCCCTACCTGCTCCGGGTC
ATCTTCCTCGTCGACGTCCCCGTCTTCGGCCGCATCAAGATCCCGCTGGACAAGTCCGGCGAGATCCCCATCCCGTACAAGCCCGACGTGGACGTGGACA
AGATCAAGTTCCACCACTTCTCCTTCGAGGAGACGACGGCCACCATCCACCTGAGCCTGGAGAACAAGAACGACTTCGACCTGGGCCTCAACCTGCTGCA
GTACGAGATGTGGCTCGGCGACGACAGCGTGGTGGAGGCGGAGCTCACCGACTCCACCAGGATCGAGAAGCAGGGGATCACCAAGATGCAGATCCCCTTC
ACCTTCAGGCCCAAGGACCTGGGCTCTGCCGTCTGGGACATGATCAGGGGCAGGGGCACTGGCTACAGCATCAAGGGCAAGATCGATGTCGACACACCCT
TTGGCAACATGAAGCTGCCCATCGACAAAGTCGGCGGTACCACTCGCCTCAAGAAGGACGACGACGACGAGGAGGAGTGAAGTGCTGTTACTGAACATAC
AAGATAGTCAAGCAGGGAGCCAGGGAGGATCCAGCTGAACTCTTCCCTCTAGCTTATGGTATCTTTGTTGATGGCATCATCCGAACATCGTCCGTGTTTT
TATGTTTCGGTGCTCAGTGTTCTTCGTGGGAACTCATCCAGTGTGTATTCTTTCCGTGTTAACTTTGTCAAGTGCAAACAGACCTGAG
page-top