Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18614  (registered. 2012)
Contig Information
Length 1046 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14334171|gb|AAK60568.1|AF384146_1|AF384146_1 thaumatin-like protein [Triticum aestivum]
Score 357
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18614
TTTTTTTTTTGAACAACAACAAATCGTATGTTTTTATTTTCCGAACTGATCTCCTCCATCAACATGCAGGAGATCAGTTAAAAAAACATAGATAATCCAC
TTTTTTTGGTGTGGAAACAAACAAGCTAGCTGTACACATAATGGCCCGCGTAGGGTCCCATGTGCTGTTCGCGCACATGGGGTGGCTCCTTTGCAACACC
GATGTCAAAGTCGTGACATTGCATGAGCAAGTAATAGCAATGGCTGACCCTTCTGGGTCAGGGTGCTTTTTTTTTTAGGGTAGATAGGTAATTTTTTATT
GCCCCGTACTGTGTACACAAATATCAATGAAACGCTCATAGTAGTGGGCTAACATGCAGTACAGTGGATGTAATATGACTATGTGATGTAGTATTAAGCA
GTACACCTTTTATTTATCCGGCCGTTTATCTACGTACGTCTTTTATTGATTCGCGGTGCGACGTAAAGAGGCTTCATGGGCAGAAGGTGATCTGGTAGTT
ACTATTGCCATTGCAGGCGTGTGTGGCGCGGTCGTTGGGGTGTTGGTAGGCTTGCGGCGGCGGGCAGCTGGGGTCCCTGCACCGGAGCGCGTCGCCGGTG
CTGCACGAGAAGTCCATGGCAAGGTTGAAGCCGTCGATCACCGAGATGTCGTAGAAGTCCTGGGTGCTGCCGCCGCCGATGGTGTACTCGGCCAGCGTTG
CCGGCGGCCGCCCGGAGAGGGAGCAGGACAGCTGGCCGCCGCAGTCGCCGGTCCGGCAGCTCCCGCTGCCGCCATTGAAGGAGCACCCGGTGCGGGCCCA
TATCCTCCCGGCTTTGGTGCCCGCGGGCACGTTGATGCTGGACGTCTGGCCTGCGCCCAGCGCGAAGCCCCCACCCACCGGGATGCCCGCCGGCCAAATT
GTGGAGCCGCAGTTGTTCTTGATGTTGAAGGTGGCCGCGCTGGCACCGGCGGCGAAAACAGCCAGGAGGAGGAAGAGCACCGCGGAGGTCGCCATTGCTG
CAAGCTCTAGTTAGCTTCAGTGCTCTTGCTGTGCTCGAGCTTTGCT
page-top