Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18562  (registered. 2012)
Contig Information
Length 707 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_CA 1
WH_SP 1
WH_XB Root 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig18562
TTTTTTTTTTAAGAGCAAAACGCATACAATTCATTACTCGAAGGTTGAGACGAGGAGAACATTTTTTTTGATTAACAACACGGCTGAATATAGATCTCTG
ATAACAACAGATAAGAGTGGCGATAGAGTGCTCTTACATCCCACATGCAACCACCGAAATTAGATCCCCACAGTGGCTACTAGATAGGTAGACACAAGCC
AGGAATTATAGAGTACACCGGCTAGTTAAACATACAGGATATAGTACTGGTAGATAGCAGAACATATGGGGTGCAGGATATAGCACTAGTAGATAGTAGA
ACTTGCGGGCACAGTAGTAGATAGTAGAACATGCGGTGCAGGATAGATATTCCAGTCATTCACCATTGAGCCATCTCCCTTCAACGAAGCCGATGGACCC
CAAGCAAAAAGGTGAGTGCTCCAAGACTGAAGCCAGCACCACAGGCCAAGGCCTCGTTCCTGCGCCTCTTCCTGTGTTTCTCTACAATCTTCTCCAGTGC
CCGGCGAAACTCTGGGCCGAAGGGGTCGAGGTCGGCAAAAGCCGGTGCCGGAGCACGAGAAGAGACGCGAACCCGCTGGACAGCGGCGGGGATCTTCTGC
ATCAGCTTCGCGGCCATGGTGCGCAGCGCCGTAGCCATACCTCCACCAACCCAAGCAGATCTGGACGGCGGCGGCTAGGGTTTCCTTCTCTCGATCTCCC
CTCGTGC
page-top