Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18553  (registered. 2012)
Contig Information
Length 810 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|71493349|gb|AAZ32779.1|| chloroplast Mg-chelatase subunit XANTHA-G precursor [Hordeum vulgare]
Score 345
Evalue 3.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18553
TATCAGAGAGGCAGTGGGAGAATTCCGACATTTACACGAAGTTATGCTCGGACTTTAGCCCTGCTGGTGCTGGTAAAAGAGAAAGAAAGAAGAAAAGAAA
ACCTACACCAAAATTGGGTCATAAGAGCTGAAACGCACGTCCCAAAAAAGTTACAGAAAGAACTAAGGACAGCTGCACAAATTACTGCACGAAACAACTT
TTATCATCAGACGGTACAAACAATAGTTGGGCGGGTGCTGATCGACGCTCCGAGATCGCTCTCTAGCTCTTCAAGTCCGCCAGCGCGGTCTTGGTGGCGG
CCGAAATCACGGCGTCCGAAGCGTTTGGCAGGTAGTAGTATTTCCCTTGGGCAACCCTTGCGATTTCCTTGGCGAATCCCGTAGATACAAACTTGTTCTC
GGTATCGATGACGAGAAGCGACATTCCTGCTTTGAATATTTTTGCAGACACATCAAGTATCTCATCCTTCAATTCTTGAGTAGATGGTCTTGGTGCGTCT
GAAGCAGCTGCAGCTTCTGGGTCATTGGATTTCTTCAGTGATACATTAGCTCTTCCATCGGTGATTGCAACGATCATGATACGCCCAACGTCGCCACTCT
TTTCAGCGTTCAATCCCACTCTGACAGCTGTACTCAGGCCATGAGCTAAAGGAGAACCGCCACCGCATGGTAGCTTTTCAAGACGTTTGCGAGCCATTGC
AATGGATCTTGATGGTGGAAGCAGAACCTCAGCATAGTCTCCACGGAAGGGAATAATTGCAACCTGATCTCTGCTTGTGTAACTTTCTGCAAGCAACTTC
AATGCTGCAC
page-top