Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18521  (registered. 2012)
Contig Information
Length 842 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|18650668|gb|AAL75812.1|| temperature stress-induced lipocalin [Triticum aestivum]
Score 399
Evalue 2.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18521
GCTCACTACAGCTTCATCCAAGCAACCGTGATCAGTTCACGAATCCACCTAAAGCGAGACACAGACCGAGCAGCGACCGGGCGGCGATAGACGATGGCGG
CCAAGAAGAGCGGGAGCGAGATGGGCGTGGTGCTGGGGCTGGACGTTGCGCGGTACATGGGGCGGTGGTACGAGATCGCGTCCTTCCCCAACTTCTTCCA
GCCGCGCGACGGGCGCGACACGCGGGCGACCTACGAGCTCATGGAGGACGGCGCCACGGTGCACGTGCTCAACGAGACGTGGAGCAAAGGGAAGCGCGAC
TTCATCGAGGGCACCGCCTACAAGGCCGACCCGGCCAGCGAGGAGGCCAAGCTCAAGGTCAAGTTCTACGTCCCGCCCTTCCTCCCCATCATCCCCGTCG
TCGGCGACTACTGGGTCCTCTATGTCGACGACGACTACCAGTATGCCCTCGTCGGCGAGCCCCGCCGGAAAAGCCTATGGATCCTGTGCAGGAAGACGCA
CATCGAGGAGGAGGTGTACAACCAGCTGCTGGAGAAGGCCAAGGAGGAAGGCTACGACGTGGCCAAGCTGCACAAGACGCCGCAGAGCGACCCGCCGCCG
GAGAGCGATGCCGCGCCCACCGACAGCAAAGGGACCTGGTGGTTCAAGTCGCTCTTTGGTAAATGATAGATTCATCCGTCTGTATATGCAGTTGGCCGGC
ACTGTAACAGCCATGATGTGTGTTCATCTGTATCTTAGTGTATTAGCTATTCTCTATGGTGTCGAATAAATGGGACTCAGTGATATGGTATACTACCGTT
TTCCAGGAAAAGACTCCATGACGAGCTTTATCAAAAAAAAAA
page-top