Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18460  (registered. 2012)
Contig Information
Length 1057 bp
Clones alternative view 52 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 4
Wh_r Root 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226531163|ref|NP_001147749.1|| vacuolar protein sorting 29 [Zea mays]
Score 383
Evalue 2.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18460
TTTTTTTTTTAAGCAGTAATTAGTTTTTTTTATTTTTGAGACAAAGCAGTAATTAGGTGGCACCAGGTGAGTTCACACACATCAACGTCCAGGGTAGATA
CTGGGCTTTCCATCGATCCAGCGACCTGCTGAGATTAACACTAAAAAAACGCCAGCGCCAACTGCTATTCAGCCGGTCACCATACTGAGTGAGAGATACA
TGAGGGGGGACGCCTCCTTGACAAACCGTTTCTGGTTGTGAGCGAGTTGGAATCATATCACGCATATCCCATTCACTAATATGTAAACACAGCTCTAGTT
TTTCATATCGAGCAGAAGGGTACAAAGGAAAAGGACCTCCAGGTCGGGGAAATTGTGGTGGTGGTGCTGGTGGTGGTGTGCTGATCAGATTTCTGTCATG
CGTAAGCACCATCAGCCATGCATCGTGGCGGTCTTCTTGAAGTCGATCTTGTCAACCTTCACCTCGCCGTCAATGAGCTCGTACACGTAGACAACAACCC
GGAGGCCATCGATGTCCATGAGCACAAAGCTCGGGTTGACGTCATATGTGATGCTGCTGTGTGCGCCTGTGCCTGAGCCAGGGTTGATGACGACACCCCC
CTCGTGCTTGTAGGCCTTGAACTGATGGGTGTGCCCGGTGACGAGGATGTCCACATCCAGCTGCCTCTGGAGCATCGCTAGGGAGTCCAGGTCGCCCCAT
GGAACAACCTGATGGCCATGGCATAGCCCTAGCTTGAACTGACCAATAGTAACTGTCTTAGTCTCTGGGTAGCGAGCATCCTCATCATATTCACCTCTGG
TAATGTGGAGATCAGGACAGAGGCTTTTAAGGTAGTCGTGAACTTCCTTGATGCAGAGGTTCCCGGTGCAGATGATGTGCTGGATCTTGCCCGGGACGAG
CATGGACTTGAACTTGGCGGGCAGGTCGGGCGCACGGTGCGGGATGTGCAGATCCCCCAGCGCTAGGACTAGCACCATTGGATTGGGGATCGGGGGGGAG
AAGGGGGACGGCCCCGGAAGGTGGAGAGCGATCCGAATCGCTCAGCCCGCTCTGCTC
page-top