Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18385  (registered. 2012)
Contig Information
Length 615 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig18385
TTTTTTTTTTAGTGCTAATCGCCACAGACTATGAGATTGCAAGAAATTGGAACCACAAACTCGTTTACAGCAGCTAGTTCGTGTATCATACCACAGTTCA
CTGTACAATTGTCTCCATTTCCTTCCCAAATGTTTCAGTTTGAATACAGGAAACACAAGCACTGGAGTACATCCATTCCACACCAAGACCAAGACAGCAG
AAGGGTGAAGAACTTCAGAAGAAGAAGAAAAACACTTATGTATGCACGCTTAGGCGTCAGTGATCACACGGTTGCAGCGTTCTTCTGGGGGCACGGCGTG
GACAGGGCATCAGGAGTGGACGGGTATGAGATCGAGATCAGCTTCGATCTGCACTTCGCTGCCCCATCATCACGATATGTGTTTGCTCCAGGGGTGGTGC
TTGGTGGGTTGGCCTTGGGGTTCAGGAGCGAAGTCTCAGGGAGGGACTGAGAGATTGCGATCAGTGACCGGCGAACAGTTTCCCGAGTGAACTCTGCTGC
TGCTGCAGGCGAAGCCATCAACCGAAGTACTAAATGCAGAGACGAGCAGAGGAGGAGACCTGGGGAGGACGGAGAGGCGAAGAGAGATCGTCGTCTTCGG
CAAGGCAATAGTCCA
page-top