Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18376  (registered. 2012)
Contig Information
Length 829 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218188512|gb|EEC70939.1|| hypothetical protein OsI_02530 [Oryza sativa Indica Group]
Score 456
Evalue 2.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18376
TTTTTTTTTTGCTTTTGAGATTACATAATGGATGGAACAAATAGAGTTTCTGTCTTATTTCTACAAGACGACCAAAAACAGAAAATGACATACAACATCA
CAGGGCAATTGACATTTCTTTACATGAACATATATATCCTAGTAATGTCTTAGATACTTGTGGTAGCATCCCACAGCCGAAGAAGTCCATTCCGGCCACC
ACTGCATATTCTTTTCCTATCCAGGTCCGATGCTATACATCTCACCACTGCAGACGTTTTCTGGGGAGTTCTATAAAGCTGCCATCCTGCAACTTTTGAT
CCTGCATTTGAGAAACTTCCGAATCGTTCTTGTGGTCGATGGAAAAGAGACATAGAATTGTCAGCAGCACCAATTCCAAGCCAGTGATCACCAGCACTAA
TGGACAGAACCGATGCCGAGTGAAGCGTCAGATTCTTAACACATTTTATGCCTCCTTCGTTTTCCCAAAAACGTATAAGCCCGTCAGAGGAACCAGTGAT
AATTCCTTTATCCGAAGGTGAGTATTCTACACAAAGTATGGGACCAGCATGGCATGCTAATACAGCATCACATGTTCCCCGTGTAAGAGACCACACCCTA
GCTGTCCAATCATCACTCCCAGTTATTATCGTTTCCCCAGTCATCCTCATTGATCTTATCCACTTTGTATGCCCTTGAAGCTTGAACATCTGCTTACTTG
AACGAATATCCCAGACATGCGCCAACACATCTCTCCCAGCAGCTGCCAGAATTCCAGTCGAGTCATCGTATTCCATACAGAGAACTGCACTTTGACAACG
ACCCACGGTAGCAACACAAGTATCAGTCC
page-top