Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18353  (registered. 2012)
Contig Information
Length 891 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|71361902|gb|AAZ30058.1|| glutamine synthetase isoform GS1b [Triticum aestivum]
Score 217
Evalue 2.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18353
CTACAGTACCGAGTCGATGAGGAAGGACGGCGGGTTCAAGGTCATCGTGGACGCCGTCGAGAAGCTCAAGCTGAAGCACAAGGAGCACATCGCCGCCTAC
GGCGAGGGCAACGAGCGCCGTCTGACCGGCAAGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGTGTCGCGAACCGTGGCGCGTCGGTGCGCGTGG
GCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGGCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCGATGATCGCCGAGACCAC
CATCCTGTGGAAGCCCTGAAGCCGATCAGCGCCGATCGCCGTGCGATGATCAGTGGTGGGTTGGGTTTGGTGGTGGCCATTGGAGGATTTGGACGAAATT
CTTCCAAGATATTTCCTTTTCCGTTTGGTTGCATACTACGCGTAGTCCGTTTAGGTAGGTCACATCATCGTCGTCGTCATCAGGGTGTCTGGTCTCTCTT
CTCTCGTCTTTGGGTGGTGGGTGGCAAGAGGCGTGTCAAACACACAGGACTACTATTGATTGTTTTCCCTTGCCGTCTGGGTGCTCTGGTCTCGTCTCGT
GTAATCATCAATTGATATGGTAATAAAATGGTCCGTACCGCAGCCGTGGTACCACGCAAAAAAAAAATCTCATGCTACGGACGGACGGGTGGTGGTGTGT
GCTTTATTACTCGCTAACGATGCAACTTTGTGTAAAGCGGTTGTTGCGCTTCCAATGGTCGTGGATGAAGCTTAGGCGACGCTGGGCCATTATTAGTGCG
CCAAGAGTGGGGAGCTACATTATTGTACCACACACATGGGATCGCTTTTCCTGAATTTCTAGTTCTATAAAATTGATAGATTCTACTAACA
page-top