Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18351  (registered. 2012)
Contig Information
Length 1407 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XF Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108862158|gb|ABA95738.2|| Hydroxymethylglutaryl-CoA lyase, mitochondrial precursor, putative,"
Score 452
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18351
CAAATTGAGAGTACATATCAATGTTTCATGATAAGTTTCACCTGACCCGAGTAAATTGATGCGGTATACAACAACCAAAATGGCTTGCGTAAATGCATAT
GCTAGACGGACAGCAATGACGTGTACTACCCCTTGTGGAGTTCCAGTATGACAATCAGGCCGTTAGCCTGCACAAAGCTGTTGCAGTCTTGGAGCCTGAC
GGGCGGTCCAGGTGCTTGCAGATGTAGTCGCCAGCGTCCATGAGCTTGCCGAGGTCGACGTTGGTCTCTATCCCCAGGCCGTGAAGCATGTACACCACGT
CCTCCGTCGCCACGTTGCCCGTGGCGCCCTTCGCGTATGGGCACCCTCCAAGGCCCGACACAGACGAGTCCACTACGCCGATCCCCATCTGGAGAGAGAC
TAGGATGTTGGCAAGGGCTTGGCCATATGTATCGTGGAAGTGAACGGCCAGCTTGTCTGCCGGAACGACAGCCATGACCGCCTCCAGCATAGGAACTACC
CTGCCTGGCGTACCGACACCAATCGTGTCACCGAGTGAAATCTCCGCGCAACCCATGTCGTAGAGTTCCTTGGCAACATATGCTACCTTTGATGGATGCA
CAGCGCCTTCCACGGGGCAGCCCACCACACATGAAACATACCCGCGGATACGTATTCCATGTTTCTTGGCAGCAGAAGTAACATCACGGTACCGAGCAAG
GCTTTCCTCGATGGTGCAGTTGATGTTCGACTTAGAGAAGGATTCAGAGGCGGATGCAAAAACCGCAACTTCTTTTGCACCAGCTGCAACAGCAGCCTCA
AATCCTCTGAGGTTAGGAGTTAACACAGGAAACCGCACATCTGGCGCATGCTGGATACCTTCAAGGACATCCTTTGCATCAGCTAGCTGCGGCACCCATC
TTGGGGAAACAAAACTTGTGTATCAGCTCAATCTTTACTGATGTCGGTACAATGTTCTTCTCATTCTGCAGACCATCTCGTGGTCCAACCTCAACCACCT
TCACAAACCTTGGGAGATCCCACGAAACCTTTTGTGGAAGAGTTCTAAACTCCATATCCGCTCCATTGCAGGACGAGTCGGTATACTGGCCTTGCAGATG
CCATGAGTGGGAAGTGCTGTGAAAGAGCGTCTGGTTGTTGCCACTGTTGCTGGGCGTGTAATTGCCGGTGCTGCGGTCATCAGCTGTTGATCTGCAGGCA
CTTTGGCAGAACCTTCCAAGTCTATTAATACTCAACTTTGGCAGGTCCCCAAGGCCAAGTGGCTCCTCGAGGCTCGACATTCTTGATCGATGGATGAATT
CGAAGCCGATCCGACGGAGTACGAGCCACAACGCCTGACGTGGTATAGGGCAGCAGACTCGCGCTCGCTTGAATCCGACGAAAAGATCGCGGAGGTCGCC
GCACCCG
page-top