Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18349  (registered. 2012)
Contig Information
Length 972 bp
Clones alternative view 87 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VHS Shoot with heat shock treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 15
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 16
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 16
WH_XE Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 10
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31753114|gb|AAH53854.1|| Unknown (protein for IMAGE:5194336) [Homo sapiens]
Score 525
Evalue 3.00E-147
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18349
TCCCAACCATCTCCACACTCTTCAGTTTTCATTGTTTGGAGAACACACAATACACCTCCCACCTTAGCAGCGCAATGGCGACCACCACCATGTCCCTCTC
CTCGACCTTCGCCGGCAAGTCGGTGAAGAACGTGGCTTCATCAGCTCTCTTTGGTGAGGCCCGTGTCACTATGCGCAAGACCGCTGCAAAGGCCAAGCCG
GTTTCATCAGGCAGCCCATGGTACGGTGCCGACCGTGTGCTCTACCTCGGCCCGCTTTCCGGAGAGCCCCCGAGCTACTTGACCGGCGAGTTCCCCGGCG
ACTACGGATGGGACACCGCCGGGCTCTCGGCCGACCCCGAGACCTTTGCCAAGAACCGGGAGCTCGAGGTGATCCACTGCCGGTGGGCCATGCTCGGTGC
GCTTGGATGCGTCTTCCCCGAGCTTCTTGCACGCAACGGCGTCAAGTTCGGTGAGGCGGTATGGTTCAAGGCCGGTTCCCAGATCTTCAGCGAGGGTGGC
CTCGACTACCTGGGCAACCCCAGCCTCGTGCACGCACAAAGCATCCTTGCTATCTGGGCATGCCAAGTCGTGCTCATGGGCGCTGTTGAGGGGTACCGCA
TTGCTGGCGGCCCACTCGGTGAGGTAGTCGACCCACTCTACCCCGGGGGCAGCTTCGACCCACTGGGCTTGGCTGACGATCCAGAGGCATTCGCGGAGCT
CAAGGTGAAGGAAGTCAAGAACGGTCGCCTCGCCATGTTTTCTATGTTTGGCTTCTTCGTGCAGGCCATCGTCACCGGCAAGGGCCCACTCGAGAACCTC
GCTGACCACCTCTCCGACCCTGTCAACAACAACGCATGGGCGTTTGCCACAAACTTTGTCCCGGGCAAGTGAGGCGTTGGCGCTCGCTAGCTGCGAGTTG
TAGCCATATATCAAGGCAACTGCGGTGAACTGCACACATAATGGGTGGTTCAAATTGTAACATCATGGTGTA
page-top