Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18339  (registered. 2012)
Contig Information
Length 1573 bp
Clones alternative view 76 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_SH - 2
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|71361900|gb|AAZ30057.1|| glutamine synthetase isoform GS1a [Triticum aestivum]
Score 746
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18339
CAGCTGCTCCTGCCGGGTGCGTGCTGGGTCGTCGCCATTATATAGCCGCCCTCCCGATCTCCCCTTGGCCTCGCACCACCCCCACGCGCCTTCCTTCCTG
CCTTCCTGCCCTCAGTCAGCCGGAGCCGGATTGCTCCTCCCGCCATGGCGCTCCTCACCGATCTCCTCAACCTCGACCTCACCGACTCCACGGAGAAGAT
CATCGCCGAGTACATATGGATCGGCGGATCTGGCATGGATCTCAGGAGCAAGGCCAGGACCCTCCCCGGCCCGGTCACGGATCCCAGCAAGCTGCCCAAG
TGGAACTACGACGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGCGAGGTCATCCTGTACCCACAGGCCATCTTCAAGGACCCGTTCAGGAAGGGCA
ACAACATCCTTGTCATGTGCGATTGCTACACCCCAGCTGGAGTGCCAATCCCCACCAACAAGAGATACAACGCTGCCAAGATCTTTAGCAACCCTGATGT
TGCCAAGGAGGAGCCATGGTATGGTATTGAGCAGGAGTACACCCTCCTACAGAAGGACATCAACTGGCCTCTCGGCTGGCCTGTTGGTGGATTCCCTGGT
CCTCAGGGTCCTTACTACTGTAGTATTGGTGCTGACAAGTCGTTTGGGCGTGACATAGTTGACGCTCACTACAAGGCCTGCCTCTTTGCCGGTGTCAACA
TCAGTGGCATCAATGGCGAGGTCATGCCCGGACAGTGGGAGTTCCAAGTCGGCCCGACTGTTGGCATTTCTGCTGGCGACCAAGTGTGGGTCGCTCGCTA
CCTTCTTGAGAGGATCACTGAGATCGCCGGAGTTGTCGTCACATTTGACCCCAAGCCCATCCCAGGCGACTGGAACGGTGCTGGTGCTCACACAAACTAC
AGTACCGAGTCGATGAGGAAGGACGGCGGGTTCAAGGTCATCGTGGATGCCGTGGAGAAGCTCAAGCTCAAGCACAAGGAGCACATCGCCGCCTACGGCG
AGGGCAACGAGCGCCGCCTCACCGGCAAGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGCGTCGCAAACCGTGGCGCGTCGGTGCGCGTGGGCCG
GGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGGCCGGCGTCCAACATGGACCCATACGTGGTCACCTCGATGATCGCCGAGACCACCATC
CTGTGGAAGCCCTGAAGCCGATCGGCGCCGATCGCCGTGCGATGATCAGTGATGGGTTGGGTTGGATTTGGTGGGTGGCCACTGGAGGATTTGGACGAAA
TTCTTCCAACATATTTGATTTTCCGTTTGGTTGCATACTACGCGTAGTCCGCTTAGGTAGGTCGCATCATCGTCGTCGTCGTCATGCATCAGGGTGTCTG
GTCGCTCTTCTCTCGTCTCTGGGTGGTGGGTGGCAAGAGGCGTGTCAAACACACAAGGCTACTATTGATTGTTTTCCCTTGCCGTTTGGGTGCTCTGGTC
CTCGTGTAATCATCAATTGATATGGTAATAAAATGGTCCGTACCGCTGCCGTGGTACCACACCAAAAAAAAAA
page-top