Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18333  (registered. 2012)
Contig Information
Length 1195 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XE Seedling, infected with leaf rust 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479519|ref|NP_001063353.1|| Os09g0454600 [Oryza sativa (japonica cultivar-group)]
Score 607
Evalue 9.00E-172
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18333
TTTTTTTTTTTTTGAAAACTGTTACAATCATCAATCTATTACAGATCATGCGATGTCAACAATAAAAACATATTTTTTTTCTCTTGGAATTTCGGAAAGG
CTTTCACTGCTTAGGCTTCTTCCCTTGGGGCAGCAGCAGGAGCCCCACCGGTTGTTGGCAGTCCAGCCATGACTTTGAAGGAATCATAGATCACCCACTG
GGTGCCGGTCAGTGTGCCGATCATGACGATGCGGAGCGGAAGGCCCCGCGTGAAGAGTCCCCAGAGGCCGAGGTTCTTGACAGCGTCTCCGACGGTGGCG
CCCTTGGCATTGTTGAGGAAGGAGACCAGGTTGTCGGCGGGGTGCGAGATGGCGGCGCAGAAGACTCCGGCGATGTAGCCGCTCCCGAAGCTCACCCCGA
GCTGCAGAGGCTTGCTGCACTGCTCCTTGGGGGTGGGGATGAGGTGCCTGTACGCCATCTCCACGATGTTCTCGTAGGTTGCGAACTTCATCATGGTGTA
AGGAATCTGTCGCCCCCAAAGAGGAACCATTCCTCTGAACAGCCCTGCATAGCCTTCGGCCCTGACGATCTTGGGGAATCCGTCGCGCAGGCCCCTGGCG
TAGCCGGGCTGCGTCTGCACCCGCACCTTGACGGCCTCCATGGGGCAGAGCGCGACGTCGGCGACGACCTCGGCGGTGGCCGAGCCGGCGAGGTAGATGA
GGGTCTTGTACTTGGCGGCGTACTCCGGGCCGGCCATGTCGGTGTACTCCTTCTTGAACACCTCGTACAGGCCGTACTTGAACGCGCCCTGCGCGCTGTA
CCCCAGGAACGTGGGCGCCCAGCCCCGGAAGAAGCCTCGGACGCCCTGCTCCTTGAGCACGATGCTGAACGACGAGGAGATGCTCTTGTACTTGGCCGGG
TCGATCTGGATGTTGCACTTGATGACATCGAGCGGCGTCACGGCGGCGTGCGTGAGCCCGCACGCGGCGGCGCCGCCGAAGCCGCAGGCCGCGTAGTACG
CCGGCGAGAACATGTCGATCTTCCCGAACGGCGGCTCGCTCGGCGCCCTGGCGACGACGGGCGCGCCCCTCCCGTCCGGCATGGCGGCGCCGCTGGACGC
CGCGTAGAGGAAGCTCGGGAGCAGCGACTGCCGCGACGCCATCGAACGATTCCCCGCCGGCGGGTGGAAGTGTCACGATCAGCCTGCTTGCTTTT
page-top