Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18324  (registered. 2012)
Contig Information
Length 629 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|84873496|gb|ABC67799.1|| UDP-D-xylose epimerase 3 [Hordeum vulgare]
Score 262
Evalue 2.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18324
TCAAGCAATTTGCTCTTACAGGAATGCTTACAGGATTTCCAGCATATCCGGATCGCTTATATTTCCACTAGCAAAAAACANNNNNNNTTGAAAACAGAAA
AAGAAAAGAACAGATTAAGAACGAAGCGACTTGGCAAAGAGTATAGAGCACCAAGAACCTATACCACTAACTACAGAATCAACATGTATTAACGATTTCA
GCGGAGTTATTGATTGCGAGCTATATCTAGTTTGCCCCATAGCCCCGCGGATGCGACTTTTGCCACTTCCACGCGACAGACAGGCTTTCCTTCAGATCGG
TGTGTTGAGCAGTCCAGTTGAGCTCACTGTTGATCTTGGTGGGGTCACTGAATACTTCAGCATAGTCTCCTGGCCTCCTGCTGAGGTACTCAATTTTGAT
GTCAACCCTAGTTGCCTGCTTGCAGGCATCGACAAACTCCTTAACGGAACGGCCTCTTCCAGTGCCAACATTATAAATGCCAACTTTACTAGGCTCTGCC
TTGTTGAGTGCTTTCACATGAGCATCTACAAGATCTGTGACATCAATGTAGTCTCGTATGCAGGTTCCATCAGCTGTANNNNAATCTATCCCTTTAACCT
TCAATCCTGAAATGACTCCTAATGCTGCA
page-top