Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1832  (registered. 2012)
Contig Information
Length 582 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_SP 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238010186|gb|ACR36128.1|| unknown [Zea mays]
Score 239
Evalue 1.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1832
ATAATGAAACAGTGTGCTGCCACACAACAAGCAGAGGCTACACAGCGACATGGTCCGAACAGCTAACGAGTAGTATTACAGAGTACCATCGAACGACCAA
GAAGATACGAGAACAGATTATCTAAGAGGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGGAGGACGAGG
CGGACGGAGGTCTGCATCTCCCTGGACGTGATGGTGGGCTTCTTGTTGTAGCGGGCCAGCTTGGCGGACTCGCCGGCGAGCTTCTCGAAGATGTCGTTGA
TGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCCGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCT
CTTCTTGGCCTTCTTCTTCTTCTTGTCGGCGCCGCCCTCCTTGGACTTCGGCGGCCGCTTCTCGGCCTTGGGCTTCTTCCCCGCCGTGGTCTTCTCCGCC
GCAGGGGTCTTCTCCGCGGCCGCCGGCTTCTTCTCCGCCTTGGGGGCCATCGGACGCTGCTGCTTCGCCGGGGAGAGGTGCG
page-top