Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1830  (registered. 2012)
Contig Information
Length 725 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 2
Wh_RDr Root of dessiccated seed 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461126|ref|NP_001054163.1|| Os04g0663300 [Oryza sativa (japonica cultivar-group)]
Score 245
Evalue 4.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1830
TCATCTCGATCCACATTTCAAGTCACGGCGCATGCCACCGCATAAGCAGTTGAGAGTCCAGCTAGACTCACTTCAGACCATACATCACAAACAGTTATTA
CAGATCAAAGATCAGAGGGTTGTATTCTCCTATCAGTACCAAACCATACCATGAATACAGCGCTGTTCGTTCGGCAAACCTACTCTTGGTATCGATCAAA
TGCCAGCATGCCACAACAGCACAAAATGAGGCCCCCCAAAGGGCCTGACGAACCAGCCTCGTTCGTCTATCGCTTCTTAAAACCGTACTTCTTGCGCTCG
TAGAAGAGGTCGGTCTTGGCGCTCCCCAGGTTCACGATCTTGGGGCACCCGTCGCGGTCCTTCTCCTGCTGCGTGCACTCCTTGCAGTAGTAGGCGTCCG
AGATGCCCACCCCTCCGCAGATGACGCACCTCCCCTGGAACGAGCCGTAGTTGCACTCGTCGCAGACGCGGACGAGGGTGCAGGGGCGCACGTACGAGTC
GCAGATGACGCACTTGCCGTCGCACTTCTCACACAGGCGGCCGATGGCGATGCCGGGCTGCTTCCGGCACATGATCAGATCGGGGTGATGCTTCGCCATG
GCTGTCGGATGCTGCTAGCCTTCGGAAGGATGAGCTCGCTGCGGCGGCGGTTACTCCTTGCTCCCCGCAGGCGACGCGCCGAGACCAGAGACGACGTCGA
CGAGACGAGGCGGGCGGAATAGATT
page-top