Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1829  (registered. 2012)
Contig Information
Length 903 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 4
Wh_r Root 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464311|ref|NP_001055755.1|| Os05g0460200 [Oryza sativa (japonica cultivar-group)]
Score 335
Evalue 5.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1829
GCAGCTCTCCCAAGTTTCTCAATATTGATAGCCGAAGCCACACAATTACAACAACCAAACCCTTAGAATATGTGTTGCGTTTTCAGAGTCAAAACCAAGA
CCTCCACAGGAGACAGGCTAATGGAAAATATACAGGGGAGAAGTGAAATTGCTAGTGTCGGATGGACATTTGGAGATCAACAGCAAAACCCTCCACACCT
GAAATGGCATGGCTAACTTCCCCAGTACTCCCATTTTATTCAGAGCATTTCCTGGGATTTCCGTACGGCGCGCCTGACCTTCTTCTTGAACTCATCCTGC
TTCTCTCTCCAGTCCTTAGCTGCTTCAATATTTGCCGGTGATTCATCATTTGGACTAGAAAGCATCGAAATGATGCTTAATACTATACTCTCAACCGTAT
GGACTGGTGTCCAACGCTCACTCGCGAGCTCATATCCGTTGGGATCATCACCAGGTGGATGAAGAATAGAAATGCATACCCGCCCATCTGGATAAACATT
AGGATGCCACATTTCAGAAGTGAATCTGACTGTTGGAGGGCTGTTCGGATAATTTTGTGGGAAGCTCATAATTGCATTGAAATAGCCTCCATCATATAGG
GTCTCGGGCGGGCCGATGATGGTGACCTGCCACTCGAAGACGTTGCTGTCGTCGACGAGCCCAGCTGAAAACCCATCGACGGGGTGCTTCGCGAGATCTC
GGAGCTGCTTCTGGAGGAGGAGGCTCGCCTGGCTGGAGGCGGTGGCCATGGGATCGGCGGCGGCTAGGGTTTTCGCGGCGGGCGGGGCGGAGGAATAATT
CGCGGCCTCGGTGGGCGGTGACGGGAATTGATGGCCGCCGCGGGCCGCCTTATTTATAGGGAGGAAGCTCGGAGAAGGGAATCGGGACCAGAGGAGCCTC
GTG
page-top