Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1827  (registered. 2012)
Contig Information
Length 1151 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Wh_r Root 5
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 7
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122220777|sp|Q4LB22.1|METK3_HORVU|METK3_HORVU RecName: Full=S-adenosylmethionine synthase 3; Short=AdoMet
Score 658
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1827
TTCGGCACGCACGCACGACCTCGCAGCGGCCTCCGCCGCTATATAAGGCGCAGCCGGGATCTTGGTACAACGCCGTGCTCACATTCCGCCTCTTCCCTCC
CTTCGGTTCATCGGCCTCCCGATCGAGCAGTAGAAGCAGCGCAAGGGCATCGCTAGCACTAAAGAAATGGCAGCCGAGACGTTCCTCTTCACGTCCGAGT
CTGTGAACGAGGGCCATCCCGACAAGCTCTGTGACCAAGTCTCCGACGCCGTCTTGGATGCCTGCTTGGCCCAGGATGCCGACAGCAAGGTCGCCTGCGA
GACCGTCACCAAGACCAACATGGTCATGGTCTTGGGCGAGATCACCACCAAGGCCACCGTCGACTATGAGAAGATCGTGCGTGACACCTGCCGCAACATC
GGTTTCATCTCTGATGACGTTGGTCTCGACGCCGACCGTTGCAAGGTGCTCGTCAACATCGAGCAGCAGTCCCCTGACATTGCCCAGGGTGTTCATGGAC
ACTTCACCAAGCGTCCCGAAGAAGTCGGCGCCGGTGACCAGGGCATCATGTTCGGCTATGCCACCGATGAGACCCCTGAGCTGATGCCCCTCAGCCACGT
GCTTGCCACCAAGCTTGGAGCTCGCCTCACGGAGGTCCGCAAGAATGGCACCTGCGCCTGGGTCAGGCCTGACGGAAAGACCCAGGTCACAGTCGAGTAC
CTAAACGAGGATGGTGCCATGGTACCTGTTCGTGTGCACACCGTCCTCATCTCCACCCAGCACGACGAGACCGTCACCAACGACGAGATTGCCGCGGACC
TCAAGGAGCATGTCATCAAGCCGGTGATCCCCGCGAAGTACCTCGATGAGAACACCATTTTCCACCTGAACCCGTCTGGCCGCTTTGTCATCGGCGGCCC
TCATGGTGACGCCGGTCTCACCGGCCGCAAGATCATCATCGACACCTATGGTGGCTGGGGAGCCCACGGTGGCGGTGCCTTCTCTGGCAAGGACCCAACC
AAGGTCGACCGCAGTGGCGCCTACATTGCCAGGCAGGCTGCCAAGAGCATCATCGCCAGCGGCCTCGCACGCCGCTGCATCGTGCAGATCTCATACGCCA
TTGGTGTGCCTGNNNNNTTGTCTGTGTTCGTCGACTCCTACGGCACCGGCA
page-top