Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1825  (registered. 2012)
Contig Information
Length 859 bp
Clones alternative view 128 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 16
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 1
Wh_r Root 9
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 5
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XA Root 10
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 14
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471704|gb|AAW50983.1|| ribosomal protein L11 [Triticum aestivum]
Score 359
Evalue 2.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1825
CGTAGGGCGCACGAAATTCGGGTGGACGAACCAAAAAATTAGAGAAGATTCGAGAGTAACCAAACAAAAGGCAGGTCATCACATAAGCCAGACATATACT
CTATTGTTGAAAGAGGATAAAACAGTAGTGAGCCTCTTAGACGAAAGTGCAGATCAAACAGAAATCATCCAGCTTGAGTACAGGCAAAACTGACAAAGCA
TTTCGGTTTCTAGGTAACATACATATCCAGCAACCAGGTGAACTTCATTAACTCAAGGTCTAAAGAGAGCTACGTCCTTCTTAGCTCGCATGGGACTTGT
TGAGGATGACACCCTCGTACTTGACCTGGAACCACTTCATGGCGTCCTCCTTGGTGACCCTCTGGTGGATACCGACGCGGGCCTTGCACCTGCGGCGGCG
GGAGACGCGGTACCCAGCACGCTCGAGCACCACAAAGAAGTCCATACCGTAGATGCCGGTAGATGGATCGTACTTCATGCCGAGATCGATGTGCTCCTGG
ATACCGAAGCCAAAGCATCCGGTGTCGCTGAAGTTCCTCCTGAGCAGCTCGTACTCCTTCACCTTCAGGCCACTCTCCAGCAGCTGCATCGCCTTCTCAC
CCCTGATAGTCACATAGCAGGCGATCTTCTCATTACGCCTGATACCGAACGACCTGACAGTGTACCTCGCCTTGGAGAACACCGGTGACTGTCCGCTCAG
CTGCTCCAGCACCTTGGAGGCGCGGGTGAGGCGATCTCCGCTCTCGCCGACGGAGATGTTGAGGACGAGCTTCTGCACCTTGATGTCCCGCATGGGGTTC
AGCTGCTTCTTCTCCGTCGACATGGCGGCGGGATCTGGGGAGCGGCGGCGGGGGAGGGG
page-top