Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18229  (registered. 2012)
Contig Information
Length 996 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242072448|ref|XP_002446160.1|| hypothetical protein SORBIDRAFT_06g002880 [Sorghum bicolor]
Score 394
Evalue 7.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18229
GAAAAACACTCCATAAGTTAAGCTGGTTGAATTTGAGGCAATTCAGGCGTGTTGGTCGCATGACAGCCCATCTACAAGCCTGCTTGCAGCCCAGCTAAAC
ACCAGCACAGATCTGGTTAAGGCCCAGCAACATGCCAACACATAACCAGTTCAGTTTCCACCCAAATTCAGAAACACTCCATAAGTCATGCATTTTATTA
AAAACAACCGCTGGACACAATGGATCAGCATCTCCTTATTTTCATTTGCAAATGGTAGGAGCATCTGGAGTCAGCAATTTATTTGAATGCACATGTGAGA
ACCAGTTACAGCACACGGGCTTCGTTTTTCAATTTGTCAAGGAGCTCGTCGACCGACGAGAGGATCACCCCGGCTTTCCTCTTTGGCGGCTCGTCCACCC
GGAGCACCTCCATGTCTGACCTGACATCCACGTTCAGGTCTGCGGGGGTGACTTTCTTGATCACCTTCGACTTCGCCTTCATTATGTTTGGCAGCGTCGC
GTACCGGGGCTGGTTCAGCCTCAGATCAGTCGTGATCACTGCTGGTAAATCCAAGCAGATGGTTTCGGTTCCACCATCGACCTCTCGCTCAACAGTAGCT
TTTTGCTTATCCTTGTCAATTATCACCTTTGATGCGAAGGTACCCTGTGGCCAGTTGAGCAATGCAGCTAGCATTTGTCCTGTTTGGTTGCAATCATCAT
CAATTGCCTGCTTGCCGAGGATGAGGAGGCCGGGGGTCTCCTGGAGCGCGAGGGCGCGGAGGATCTTGGCGACGGCGAGCGGGAGGAGCGGGCGGGCGGG
GTCGGGGTCGTGGAGGACGTGGACGGCGCGGTCGGCGCCCATGGCGAGCGCGGTGCGGNNNGTGTCGGCGGCCTGCGCGGGGCCGACGGTGGCGGCGACG
ACCTCGGNNGCGGCGCCGGCCTCGCGCAGCCGCAGCGCCTCCTCGACCGCGATCTCGCNNNNNNNGTTCATGGACATCTTGGCGCTGGCCGTGTCG
page-top