Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18205  (registered. 2012)
Contig Information
Length 1621 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_RDr Root of dessiccated seed 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125541476|gb|EAY87871.1|| hypothetical protein OsI_09292 [Oryza sativa Indica Group]
Score 210
Evalue 5.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18205
TTTTTTTTTTCTACCACTGACATACTTTATTTCACGGATTATAACACTATGATCGACCGATACAGACTTCGATATGACCATGAACAACTCTTACCTAACA
TAACTCAGTTGCTAAATCAACTACACATAGCCTAGCTGATGCAACTAGACACACTTCTCAGTCGCTACACCAACTACACATAGCTCAGCTGATGATGCAA
CTACCTCCATACTTTTCAGTATATATAATTTACCTCATAACTCATACCTTCGACCCACACACGCACACATAAACTTCAATTATTAACATCACTGCAACCA
AACCTGAGACCCACTCCCTAGCTACCAGATTATCGCCACCTAAACCAAGAACCAACCCTTAATCATTCTGACTGACCGACAATTAACAAGCTACCTAACG
ACATCAAGGCGAACCAAACACCTGTGCAGCAGCAGCAGCACCGCGCGAACCTAAAGCAACCACCACCAAACCCTACCGCCGGACCTCCGCTCCCCCGATG
ACCCTTCCTCTGAAAAAATACCGGAAGGGTTCGATCGGAACGGAGCCGGGATCTGATCCGGCCAAGCTTGCCGCCGGACCCATCCGCACACCGACCATCC
ACAGATAAAATCCTTCCATCCTTCAGTCAGGGAGAGTTATTACCACCACCACCACCTCTTCTTCTTGTTGTTGCTTCGGTGCAGAGGCGGTGATACGAGG
GGGAGGAGGGAGCAGAGCAGAACGGCGCGGCCGCGGAGGGGGCGCACACGACGCTGCTGGAGGGGGAGCCGTCATCATGAGAGCTCGCCGATGCGGAGCA
GGCACCGGAGGCCGCGGGTGGCCTCTTCCTCTGCGCGCCGGAAGAAGAACCCTGGGAGGGGGAGGGAGCTCGGCTCCGGGGCCGCGGCCGAGAACGCCGG
GCCCGCATAGCTGGTTGCGATGGCGACTGGCACCATCTTTTTAGTCGGGACGACGGAAGGTTGCTGCGGGCCGATCCGGCTGGTGGTCCGGAGCGCCCTC
TTGTCGGCCGGCGGGGCTTGCGCCCGGGCCGACGCGATAGGTGCCGAGGCTGGGGGAGGAGACCGTACGCGCCTGTCCGCTGGCGGGGCTTGGGGCCGGG
CCTTGACGACGGGCGGTGAGGCAGGGGAGGGAGACCGCAGACGCCTGTCCGCGGGCGGGGCTTGCGCCCGGGCCTGGACAGGTGCAGGGGCGGGTGAGGG
GACCGGGGGCTCCTCGCCACGCTTGAGGATCCGGACGGCCTCCATCACGATGGGTTGCTGCCGGGGCTTCTCCTTGGTCGGGGACGGCTGCTTGCGGGCA
GGCTTCGCCGGCGGGGACCGACGGCCGGCCGCGGGGGCCTGCTTCAACGCTGGAGACGCCAAAAGAGCCGGCTTTGGCGGCGAAGAGCCGGCGACCACCT
TGGGCGGCGGCGAGGCCGGCTTGGGGTGGCGCCGGCGGCGCTGCTTGGCGGCCTGGGGGGAGGCGGCGAAGGCGTCGAGATGCATCCTGTTGGCGAGCGC
GTCGTGGGATCTGAGCACCGCCGTGGCCATGGGACTAGATCGAGTGGATCCGCTCGCTGCTTGGCTCAGGGGGGCGCCGTCGTCGGGATTTGCGGATTGC
GCCGCGCCGCGCCGGAGACCT
page-top