Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18096  (registered. 2012)
Contig Information
Length 790 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|164456248|dbj|BAF97627.1|| agmatine coumaroyltransferase [Hordeum vulgare subsp. vulgare]
Score 412
Evalue 2.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18096
TTTTTTTTTTCACCATCTTAAAATCTTGTTTATTAACTCTTCCAAAACAGCATGGACAATTGAATCAAGAACTTCAAATAATACAACTAGGCAACTAGCT
ATACGTTGAGCCGATACCAGGCACACATTATTGGCACATGGCAGGTATACGTGCAAGCGGAGCTAGTCGAGGGTGTAGCAGCAGTTCTTGAAGGTGTTCA
TGTCGCGGCTGAAGAGTGGCACGTAGGCGTCCACGCTGCCGTCGCCCAAGAAGGAGGGCAGCAGGATGAGCAGGCCCTCCACCGGCAGGTAGCTGGGCAT
GAAGAAGAACGGCCGGCCGCCGCCGAAGTCCATGTCGTAGAACGGGATCCGCAGCCAGCTGTCGACCTCGATGTTGGGGCTCAGCACCATCTCCGCCGCG
TCGGCCGTCGCCACCAGCCGCTCCTCCTCCACCGCGCCGGAGTTGGCGAAGTCGATGAAGGACTTGAAGTAGCCGTCGTTGATCCGGGCCACCTCCCGGC
TGATGAGCTCCACCGCGTGCTTCACCGGCCTGGACACGAGTTCACCCGCCGTGGTAGTGGGCCGCGCCCAGAGGATGACGTTGCCAGTGTATCCGTCCGG
CACCTGCGGGCTCATCCGCGCTCTCCCGTCCACCGCGATGGCGACGCTGGTGCTCTCCCCGCCGTCGAGCCCGCGCGCCATCGTCATGGTCCGCCACAGG
TGCGCCACCACGCACTGCAGGGTGCTGCAGGGCCTGGGCGCGCCAGCCGACGCCTGCGCCTTGAGCCTGGAGATGAACTCCCGGCTGAAG
page-top