Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18084  (registered. 2012)
Contig Information
Length 1376 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_RDr Root of dessiccated seed 2
Wh_VHS Shoot with heat shock treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XE Seedling, infected with leaf rust 20
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115336282|gb|ABI94363.1|| fructose-1,6-bisphosphatase 2 [Oryza sativa Japonica Group]"
Score 642
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18084
GACCCCTCCCTGGTATGACGTACCGCTCTCTTGGAGTACTCCCTCTGTAAAGAAATATACGATCTTATATTTCTTTACAGAGGAAATACTTGTTAAAATG
GCGTGCAATATGTCAAATATATGTATACACGGATATTGTTACATCGAGGCCATGACAATGATCTCAGAATCACCATAACACTACCTAAGGAGTTTTGTCA
CAACGCGGAACATAACCTTTTCTTTTAGCTACCCGATGCGGAACATGTGTATGTGTCTTCAGGTACTCAGATCAGGCGGTGCTCGACTCCGCAGCGTACA
GTGATTTAATCTCCTCCACATCATCGTAGCTCCCGAGGAATATCGGAGACCTCTGGTGTATCTCAGAAGGAACAATTTCAAGGGCCCGATGTTTGCCGGT
GAAAGACTGGCCTCCGGCTTGCTCCATCAGGAACGACATGGGGAAAACCTCGTACAGAACACGAAGCTTCCCGTTGGGGCTCTTCTTGTCGGCGGGGTAC
AGAAATATGCCTCCGTAGAGCAGGGTGCGATGAACATCAGCAACCATACTTCCAATATATCTCAAGGATTTTGGTGATGAGCCGTCTTGGGGAAACTTGC
ATCTCTCTACGTACTTCGCTGTAGGCGCGTCCCAGTTTCTGGCATTTCCTTCGTTCACCGAGTAGATCTTCCCTTTGTTTGGTATCTTTATGTTGGGATG
GGTAAGTATGAACTCTCCCAGGGAAGGATCAAGAGTGAAGCCATTTACACCGTTCCCAGTGCTCAACACAAGCGTGCATGAGCTCCCGTACATGCAGTAG
CCAGCGGCGATCATGTGGGTCCCGGGTTGCAGCACGTCCTCCAGAGTCGCGTTGTCCTTGTCTTTGATCATGTAGATTCCAAAGATCGTGCCGATGGAGA
CGCCGCAGTCGATGTTGGAGGAGCCGTCCAACGGGTCGAAGCACACGCAGTACTTTCCGCGGAGGGGCGCGTCCACGAAGATGGCCGCCTCGTTCTCTTC
AGACACGAGCACACAGGTGCGGCCGCTGCTGACGAGCGCCTTGACAAAGACCTCGTTGGAGAGCACGTCCAGCTTCTTCTGCTCCTCCCCCTGGACGTTG
GTCTCGCCGGCGAGGCCGATGAGCTTGGCGAGGCCGGCCTTGTTGACGGCGGAGGCGACGAACTTGCAGCCGAGGACGATGTGGGAGAGGAGGATGGTGA
AGTCGCCCCGGGACTCCGGGTGCCGCCCCTGCTCGTTCAGCGCGTGCCGCGTGATCGTCATCAGGTCCGTCCGCTGCGCCTCCGCCGCGTGGTCCATCTC
CTCTTCTCGCCTGGCCTCCGCCGAGCAACGGCGCTAGCTCTTCTCGGTCGTCGGGAGCGAGCGACGGATACAAACA
page-top