Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18075  (registered. 2012)
Contig Information
Length 1170 bp
Clones alternative view 60 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 9
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|451193|gb|AAC37416.1|| wali7 [Triticum aestivum]
Score 439
Evalue 4.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18075
TTTTTTTTTTATGGTCTTTGTGAATAATTAATAATATGGCTGCATGCATCGTTCCGATGCAGAGGCCGGAGGTACATCCTACTTTGCTAAAAAAAACCTA
CATTTCCTTAGCCCCATGGTACACGCATAACAACAGAGATCGAGAAAGCCTTTTTTTAGATGGAAAAGGAAGAAAGCTTATTTGCTACTACATTAATTGT
AACATCCAACTGAAGACGGCCGGTCTTGAATCCGCTGCGAGAATTTGAACAGCTAGAGATACAGATGATCAGATACACAACCGAACAGTTCACATAAGAT
CACACAAGAGAGTAGCACACGCGCCTTGTTGCATTATATTACACCACCACCACACGAACGGCGTTGCCTGCTTTGCCCAGCGACGGAGACGGGAGAATCT
CCTACTGAAGTGCCGCGACAACGGTAGACCCTTCCACCATGAAGGTTGCACCACAGATTTCCTCCTCATCTGCGGGCACAGCGGTCACCTTGTTCTTGGG
ATTCTCGTACGACTTGAGGCCTCCAAGAGCGTTCCAGTAGAAGCAACCTTGCGGGAAAGGCGCCAGTGACTTGCCGCAAGATCCTTTCAGCAGGTCGATG
TCGTCGGAGAAGGCGACGCAGCCGTCGGCGGTGATTCCCCAGAAGAGCGGTACCTTGCCCTCCGGGTCCGATGCGACGAGGAGGGAGGAGGTGGACTTGT
CGAAGAGCACGAAGGCGTAGCTGCCGGTGAGCTGGGACAGCATGAAGCTGGCGGGGTAGGGGGCCCTGTCCCTCAGCGTCTTGTAGGCCTCGATCACGAG
GAGCACCTCGTTGCCGCCCTTGGAGAGGCCGTACTGCTGGCTCAGCCGCCCCAAGTTGTCCAGGACTCCCTCGAACAGGCAGAAGATCTCATCCTTTGCA
GCGAAAGACCTTGGCAGGAGGAGGGACTGGTTGGCGTGGGAGTAGGCGAGGTTGCCCAGCGATCCCAGCTCCACGGACACGGCCGGCTCGGCGCCGGCGA
GGAAGCGCTTCACCAGCTCCGACGCCCGCGTCTTGGGCGACGGCGTCCGGCTCCCGGCCGCCACCAGCTCCGCCGGCACCTCCACCACCTCGCCGCTGAA
CACCGCCAACATCCTGGCTCAAACAAACAAACCACACCTAGCTAGGTAAGGTATTACAGGGTCAGTTGCT
page-top