Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1801  (registered. 2012)
Contig Information
Length 1348 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_OKCS Seed DPA5 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115476900|ref|NP_001062046.1|| Os08g0477800 [Oryza sativa (japonica cultivar-group)]
Score 230
Evalue 3.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1801
AGCTCATACAATGTGCTAACTCAAGATAACCTGAGCATTGGGTCACTCATGCCACCGCATCGATCACAGCAGATCCTACCACCTTTCGGATTTAATCCAA
GTCGCGACTTAATATCTTAATAATCAATTCGGTACAGCACTGAGCGACTGCGGCTCGTCTTTGCGCTGATACAGATAGAACTAACTGTGCGCTTACGTGC
GCAGCAGCTATGTCCGGGCCGAATCTTCCGTAAACAAGAACAGAAATTGGCACTAGTAAACTAGTAGGTAGATCAGGTAGGCAACATAACTACAGGTTTC
CATACAGAACCAATGGTGTGCTTACAAAATATCATCAACGGGCGACTGCAGCAGAACCCTTCACGTCGAACGGAGATCCCAACGGCGCGATCAGGCCCAG
GCTCTGCATGATCTTGATCTGGCGCACGCTACGCTGCTCCGATCCCCCCGCGCCCAGGAGAAGAGTTGGGGTCCTTGGTCTCCGGCTTTGCCGCCTTGCC
CTTTCTAGGTTTCTTCTTCGCAGCACGGCTTGAGTCAGCCTCCAGCCCACTAGCGGCCCGCTTGGTGCTTAGTCCACCCTCTGTCTCAGTAGTAGTAGCA
GCAGTCGCCTTTGCCTCGGTAGCTTCACAGATTCCAAAGATCACTTCATCCACATATGCCATTTCAGCAGCAAGCTGCCTGTCTATGACGTCCCCCAGCA
GTATATCCCTGACCATAGCTTTTATCTTCCGGTGGGTTCCTTCGACCGTCAAACCAGTTTTGTGCTGGCTTCGATTCACGGATGTCATGTCTCCTGCTTC
AGCTGCATTTTCACTTGCGCTTGAAACATGGAGCTGTGATGTGCTGTCCTCCGCCGCATCTGAATGTTCCTTCAGATTGGTACGGCCCGACCGCTTTGAG
GATCCTTCCTTTTTGGCCACCGATGTTCCTGATGATGCCTTCTTACCACTCTTTTTATCTCGCACAGCAGAAGCTTGCTTGGGTGTCTTATCTCTTAAAC
CTTCAGCAGAATCTATACTCAAAGCTTTGTCAAGAGCACTTGCTTGCCTCACACCTTTCTGCTTTTTTCCTTTCTGAGCAGCACCTCCACCTTCTGCATT
GCTCCGAACTTCTTGGTCCTGCTCTAAGGCTTCTTGCTTTCTGACTTTCTTAGTAGACGTCTTGGCTTTTGTGTTGACAGCTTCCTCCTCGTCATCACTG
GCCGACTTAAAATGAGAGAGCTCCTTCTGAAGCACCTCATGGAATGCTTCCATGGCTGTCTTATTTTCTTTCTTCAGAAACATTTCGAATTCCATGTTAG
ACTTCCAAGGGTCAACATACAAGTCTAGGCATGTGCCATACAGTCGAA
page-top