Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig18009  (registered. 2012)
Contig Information
Length 980 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222618703|gb|EEE54835.1|| hypothetical protein OsJ_02282 [Oryza sativa Japonica Group]
Score 614
Evalue 5.00E-174
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig18009
ATGATGAACTCCAATCCGGAGACTGTCTCAACTGACTATGATACCAGCGACCGGCTGTACTTTGAACCATTGACAGTTGAGGATGTAACAAATGTCATTG
ATTTGGAGCGCCCAGATGGTATAATTGTGCAGTACGGAGGGCAAACTCCTCTAAAGCTCGCCCTTCCGATACAACGCCATCTAGAGGAGAAGAAGCTGCG
GTCTGCTTCAGGCACAGGATTTGTGAAGATATGGGGAACGTCACCCGATTCTATTGATGCCGCAGAGGACAGAAAAAGATTTAACGCAATTCTTGAAGAG
CTTGGGATTGAGCAACCTAAAGGAGGGATAGCAAGAAGTGAGTCTGATGCGTTGTCAATTGCTTCAGAAGTAGGCTACCCTGTTGTTGTCCGGCCCTCAT
ATGTTCTTGGTGGACGAGCAATGGAGATTGTGTACAATGATGAAAAATTGATAAAGTACCTTGCGACTGCAGTGCAAGTAGATCCAGAACGGCCTGTCCT
GGTGGATAAATATCTGAATGATGCAATTGAAATTGATATTGATGCATTGGCAGACTCAGTTGGGAATGTTGTGATCGGTGGAATTATGGAGCATATTGAG
CAGGCTGGTATACATTCTGGTGATTCTGCATGTTCTCTTCCCACTAGAACGGTCTCAACCAAGTGCTTGGATATTATTCGGTCATGGACCACAAAGCTTG
CAAAGCGTCTCAATGTCTGTGGGCTCATGAACTGCCAGTACGCTATCACTCCTACTGGTGAGGTGTACCTTCTTGAGGCAAATCCACGAGCTTCACGCAC
AGTCCCTTTTGTCTCAAAAGCAATTGGCCACCCGTTGGCTAAATATGCATCTCTGATCATGTCTGGAGTGACCTTGCCAGAGCTTGGGTTTACGAAAGAA
GTGATTCCTAAGCATGTTTCTGTCAAGGANNCTGTTCTTCCATTTGAGAAATTCCAAGGGTGTGACATTCTTCTTGGACC
page-top