Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17956  (registered. 2012)
Contig Information
Length 1785 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479375|ref|NP_001063281.1|| Os09g0440300 [Oryza sativa (japonica cultivar-group)]
Score 962
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17956
CAGAGCCAGAGCCCACCTTCCAGAATCAACCCGCCCGCCATGGCGAGCTTCGCGAGGCAGGAGCACCAGTTCCTCGCCGAGCTCGGCCTCGCGCCGCGCA
ACCCGGGCTCCTTCGCCTGCGGCGCCTGGGGCGGCTCGGGCCCCGTCGTCACCACCACCAACCCTAGCAACAACGAGGTCATTGCTGAGGTCGTTGAGGC
GTCCATGGACGACTACGAGAAGGGCATGAGCGCCTGCTTCGACGCCGCCAAGACATGGATGGCTATTCCGGCTCCAAAACGAGGAGAAATTGTTAGGCAG
ATTGGTGATGCACTGAGAGCAAAGCTTCATCACCTTGGCAGACTTCTGTCACTTGAAATGGGGAAAATTCTCCCTGAAGGAATTGGGGAGGTTCAGGAAA
TTATTGACATGTGTGATTATGCCGTGGGGCTAAGTCGTCAGCTAAATGGATCCATCATACCATCTGAACGCCCAAACCATATGATGATGGAGGTCTGGAA
TCCTCTTGGAGTTGTTGGTGTCATCACAGCATTCAATTTCCCTTGCGCCGTGCTCGGTTGGAATGCTTGCATTGCTTTGGTCTGCGGCAACTGTGTTGTC
TGGAAGGGTGCTCCAACTACTCCATTGATCACTATTGCAATGACTAAAATAGTGGCTAGTGTATTTGAGAAGAACAACTTGCCAAGTGCAATCTTCACAG
CTTTTTGTGGGGGTGCTGAAATTGGCCAAGCAATTGCTCTTGACACAAGGATACCTTTGGTTTCATTCACAGGAAGTACAAAGGTTGGTCAAATGGTTCA
GCAACAGGTTAGCGCGAGATTTGGTAAATGCCTTCTTGAACTTAGTGGGAACAATGCCATTATTGTCATGGATGATGCAGACATTCCACTAGCTGTGCGG
TCTGTTTTGTTTGCTGCTGTTGGCACAGCAGGACAACGATGCACTACATGTCGTAGGCTGCTTCTTCATGAAAGCATATATCAAACATTTCTTGATCAAC
TTGTTGAGGTTTACAAACAAGTCCGTATCGGGGACCCTATGGAAAAGGGCACCTTGCTGGGACCACTGCACACTACTGCATCTAAAGAAAGCTTTTTGAA
AGGCATCCAAAATATCAGATCCCAGGGAGGAAAAATCCTTCTAGGAGGATCTGCTATTGAATCAGAAGGGAACTTTGTTCAACCAACAATTGTGGAAATT
TCACCTTCTGCGCCAGTTGTGAGGGAAGAATTGTTTGGTCCTGTCCTTTATGCCATGAAATTTCAGACCCTGAAGGAAGCAATTGAAATCAACAATTCTG
TTCCTCAAGGACTGAGCAGTTCTATATTTACAAGGAAACCAGATGCTATTTTCAAGTGGATCGGGCCTCATGGTAGTGATTGTGGTATAGTGAACGTAAA
TATACCCACTAATGGTGCTGAAATTGGTGGAGCTTTTGGTGGAGAAAAAGCAACCGGTGGTGGACGAGAAGCGGGAAGTGATTCCTGGAAGCAGTACATG
AGGAGGGCCACTTGTACAATCAACTATGGAAGCGAGCTGCCTCTAGCACAGGGAATAAACTTTGGCTAGTTTGGTGCTGGAGGACTGCCAGTGAAACGTC
GTGCTGCATCTTGGGGATAAGGTGTTGCCGTGTTGAGATATCTGCAGAGTGCAGCCATCATCTTCAGGAAATTCTCTATGTGTCGATCATTTGTACCCAA
ATTGCGACGCTGCTGCTGAGTACATATAATAAGAGATGTGTTGATTCTCATGTATGCATTGTTCATTCCTTTTTGACATGTTTAA
page-top