Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17906  (registered. 2012)
Contig Information
Length 992 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_VABA Shoot with ABA treatment 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_SP 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|162463575|ref|NP_001105839.1|| LOC732740 [Zea mays]
Score 495
Evalue 3.00E-138
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17906
AACTATCAATTTAAGCACACCATCGAAACAACGTGTCTCGTTGCTCAATTATACAATATTAATAACAACAAAAGGGGAACATAGCCCATCCATTATCAGC
ATGGAAGTATAGGTAAGTTACTGGGCTAGAAAGAACTCTCGGACTCTTAAGGGTAAATTACATGTACTCCAAGCTGGACTAAGAATAGCTTCTAAAGAAC
GTGACGACAGTAGCTTAGTTAGCTAGACATCATGATCTGGTCACACGCCTGAAGGGCCTGGTTTGCATAGTATCGTACATCCACATCAGGGTCCTCGCTC
AGCTCGACAAGGCATGGCTTCACAGTAGATTGATCAAGGATTGGTACAAGCGACTGCAGAACTTTCGCAACATTGAATTTGATGTTCGGCACTCTGTCCT
TCGAGGAATTAATGACAACAGGGAGCAGCTTTTGGCATGTTATTTCTGCACCCATGACAGGGGCTAGCAATGAGATAGCTTGCAGGATGGTCATGCGATA
CAGATAATGTGGGTTGTTTATCTTCTCCAACACCTGAGGAATTATATGTTGCATTGCCCACTCTGGACCAAACTCCTCCGCCAGGCGCTTCAAGTTGTTT
GCGGCAGCTTCTCTGATCGAGAAAACCTTATCTTCCAACCATTGCATGCAAAGTGCCCCCAGCTTGTCATCAAAAAACCCAACACCTAACTGACTAGCCA
GCAGAGGGATGTACTCAATTATTGCAAGGCGAACCCTCCAGTGCCTATCCTCCGCAAGTTCTACAATAGCCGGCAATAGAGATTGCGACAGCAAGTCAAT
TCCAATGACCTGATTAACTTGATCAAGCTTGCTGATTATGTTGAGTCGAACATCAGGAAATTCATCCTTCAGCAAAGAAAGAAAAATAGGAAGAAGTTGT
TCAATGGTAGCATCCTTCCCCAAGACAGGGGCCATTCCCATGATGACTGAAGCCAAAGCTGAGCGAACATGCTGAGACGAATCTGATGACAA
page-top