Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1790  (registered. 2012)
Contig Information
Length 897 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XE Seedling, infected with leaf rust 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22022400|gb|AAL47688.1|| glutathione-S-transferase 19E50 [Triticum aestivum]
Score 437
Evalue 6.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1790
AATTCGGCACGAGGAACACACTAACACAACCCGATCTCTCACTCTCTCGCGTGTAGCAGCAACCAAGGGAAAAAATGGCGCCGGTGAAGGTGTTCGGGCC
GGCCATGTCGACGAACGTGGCCCGGGTGCTGGTGTGCCTGGAGGAGGTCGGCGCCGAGTACGAGGTGGTCGACATCGATTTCAAGGCCATGGAGCACAAG
AGCCCCGAGCATCTCGTCAGAAACCCGTTCGGCCAAATCCCTGCTTTCCAGGATGGGGATCTGCTTCTCTTCGAGTCACGCGCAATTGCAAAGTACGTGC
TTCGCAAGTACAAGAAGAACGAAGTCGACCTGCTGAGGGAAGGCAACCTCAAGGAGGCCGCCATGGTGGATGTATGGACGGAGGTCGACGCGCACACCTA
CAACCCGGCCATCTCGCCGATCGTGTACGAGTGCCTCATCAACCCGCTGATGCGCGGCCTGCCGACCAACCAGACGGTGGTGGACGAAAGCCTGGAGAAG
CTGAAGAAGGTGCTGGAGGTCTACGAGGCGCGCCTGTCCCAGCACGAGTACCTCGCCGGGGACTTCGTCAGCTTCGCCGACCTCAACCACTTCCCCTACA
CCTTCTACTTCATGGCCACGCCTCACGCGGCGCTCTTCGACTCGTACCCGCACGTCAAGGCTTGGTGGGAGAGGCTCATGGCGAGGCCGGCCGTCAAGAA
GCTCGCCGCACAAATGGTTCCCAAGAAGCCGTGATTTGCTAGGCGGGATTTCGCATCGTGGGATCCGATTCCGATCACTGATCTGCGTGGCGTTTTCTTG
TTGGTGTCGCGAATAAGGCAATGAGCTTGTGTGGCTGGAATTGCACCAGCGTGCAGTTTTTGTGCTTGCGTATCGTATGTGTGGTTGTGAAAACTCT
page-top