Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17835  (registered. 2012)
Contig Information
Length 879 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458492|ref|NP_001052846.1|| Os04g0435100 [Oryza sativa (japonica cultivar-group)]
Score 429
Evalue 3.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17835
AACGCCGAAGCCCACGCTCCTCTCTTACCCAGCACACGAGAGGGAGAGGGAAGGCAGCTTTGTCACGAGAGGACCGACTGCTCCGCCGCCGCACCCTTCC
CGAGACACGGACTCCCGAGGCAGGCATCACCGTGGACGCGCGCGCGCTGGTCGAATCGGGGAGGGCTCGGGAAACCTTGGAGAAGGGCGGCGGGGACGGT
AGGTACTCGCCATGGCCGGGGCACAGGTGGTGGACTCCGGCGAGAAGCGCCTCAACGAGCTCGGCTACAAGCAGGAGCTCCGGAGGGAGATGACGCTGTT
CAAGACGCTGGCCATCTCTTTCTCCACGATGACGCTCTTCACGGGGATCACGCCGCTGTACGGCAGCAGCCTCCAGTACGCCGGGCCGGCCAGCCTCGTG
TGGGGCTGGGTCGTCGTCTCATTCTTCACCTGGTTCGTCGGCATCGCCATGGCCGAGATCTGCTCCTCCTTCCCCACAACTGGCTCCCTCTATTTCTGGG
CTGCTCATCTCGCTGGCCCGGTCTGGGGTCCATTGGCATCCTGGTGCTGCGCTTGGCTGGAGGCCATAGGCCTCATTGCCGGAATTGGTACACAGGCCTA
TGCAGGATCCCAGGTGCTGCAGAGCATAATCCTGCTCTGCACCGGCACCAACAAAGGCGGCGGCTACCTGGCCCCTCGCTGGCTGTTCCTCGTCATGTAC
CTCGGGTTAACCTTCATCTGGGCCGTGTTCAACACTTTCGCCTTGGAAGTCATCGCATTCCTCGACGTCATCTCCATGTGGTGGCAGGTGGTTGGCGGCA
CGGTCATAGTGATCATGCTGCCGCTGGTGGCGANNNNNNCGCAGCCGGCGTCGTACGTGTTCACGCATTTCGAGACGAC
page-top