Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1779  (registered. 2012)
Contig Information
Length 1749 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242066226|ref|XP_002454402.1|| hypothetical protein SORBIDRAFT_04g030200 [Sorghum bicolor]
Score 885
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1779
TTTTTTTTTTTTGGCTCAATAAAAACCCACTATAGCTGTCAGTTTTAATAGATCCACATAAGCAACAACATTCCGAAAGGTTTAACTGCTAATCACAAAT
TTTGGGAATACAAAAGCTGGTAAAACCAGCCAGGGGTTTACAATCGCCTGCAGTTGTTTGACATCCTCCGCTTCTTCAGTTCTGAGCTGCCGCCGCCGGT
GGCTGCTGCTGAGCAGGAGGTGCTTGAGCCTGCTGCTGCCCTGCCGGCGGTGGTGCCGGCTGCTGGGATGAACTCCCGTGTTGCTGGTGCGCTGGGGGTG
CCAGCATTGGCCGGTATGGCGGATACTGGGGTGGGTACGGCATGCGAGGCGGGGCCATGTAACCGCCGCCATATGGTGGGGGTGGGTAGTATGGAGGGTA
CTGAGCACCCTGGTAGTAAGGCGGCAGCGGCGGACGCATAGGATAGCCCTGTCCTGAGCTGCTTGACGCCTGAGCTTGCCCGGCATGCTGTGGCCCTGGC
TTGCTGCCATCGCCCTCCTGCGACCTGACTACAGCGCCCATCCTCTGGGGGTCCATTGAAGGGTACATCCTCTGATCCACCGCTGGCGGTGGTGGGATGT
TGAAGTAGCCCGTTCCTGGTGGTGCCACTTGCTGTTGTCCCTCCATCCCAGGTGGCTGAGGCTGGTCGCTGCTATGCTGCTGGGATATGACAGCCCTAGG
GAGCAATCCTCCGTGGGATACATGGCCTTGCCTCCCAGCCTCATCATCATCTGGCCTTGGGGCTTGAGGCTTGCCCCACATGAGCTTCAGGCGCACACCC
TTGATGACTAGCTTGTTAGCAAGCTCCTCTGCAGCACGCTCAGCGCCTTCTCTAGTTGTGTATGTCACAAATGCACAAGCACGCTGGATTACCATCCTGA
TGGATTCAATCTCACCATGTGCATAAAACTGATCCCTCAAATCCTGCTCACTGACTCGGTTATCAAGTCCACCAATGTAGAGGGTCCTTATAGTCTCATC
ATCTGGTGGTTGCAGAGATGGCATCTCACCTGCCTTACCCAAAAGCTTGAGAGCCACTGGGTCATTAACTCCATAGTAGCGATCTTTGATGTTCTGCTGG
GATAACTCCCCTGTCTCAGGCATCTCGTGGCGATATGGGCACTCAGCGCCTCTTGTACATTCACCCCGCACATAGAAACTGCAAACATGAGCTCGGTTCC
TCTTGTAATATGGTGAAGTCCTCTGAAGCTTCAGAATGGTATCATTTGGACGGGCCTTTCCATATGAAGAGTCATAATCTATGCCAGCTGCAGCCTTACG
ATCATGCTCTTCTGCAAAGTACTCACGGTTGACATCACTCCTTGGAATTGCATCATTCGAATTGATCGCGAGTGCAGTATCGCGGACCTGAACTGGCAGA
CCATATTCAAGGTCCAGAAGGCAGACCTGGCAGACGTTTTTCAACTTGCAGCACGTCTGGCAGATCTCTGTCTTCTTGTACCTTGCGTCCCGACCAGGTC
TCCAACGGAAGACAGTAAAAGGACGCGCACAGATCTTGCATTCCTTGTCATATTCTGCTCTCAGCATGCGGACGTAGGGGTTGTCGCCGAGGCACGACTC
GCAGATGATGGGGAAGTCGGACCGCTCCCAGCCGTCGGCCTGCGCGTCCCGCAGCAGCCGGTGCGCCATCGCCGCCGCCGCCGCCGCCGATGCAGTCGCC
GAGGGGCAGCGAGAGCGAGAAGAGAGCGCACGGGACGAGGCCTCGATTC
page-top