Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17783  (registered. 2012)
Contig Information
Length 1296 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|208293677|gb|ACI25443.1|| hypersensitive induced response protein 3 [Triticum aestivum]
Score 563
Evalue 2.00E-158
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17783
GCAATGATTTTCACGGCAGAGGTCTTGCTTCTTCCGCTGATCCTCATCTACAATGCCTGGCTATTTAGGGCCGCGGCAGCGGGGTGGGGGGAACGAACAC
AACAGACGCCGTCCTCCTGCCACTTCACCTCTCCCACCTTTCCCCACTCTTCTCCAACCCCCGGACGCAGGTACTACCAGAAGTGATCGGAAGCCTGCAG
TATGGGCAATCTGTGCTGCTGTGTTCAAGTTGACCAGTCTACCGTGGCCATCAGAGAGCAGTTTGGGAAGTTTGACAGTGTGCTTGAGCCAGGATGCCAC
TGCCTGCCTTGGATCTTTGGGAAACGTGTAGTTGGCCATCTCACACTCAGGTTGCAGCAGCTGGATGTGCGCTGTGAAACCAAGACAAAGGACAATGTGT
TTGTCACTGTTGTTGCATCGATTCAGTACCGACCTCTGGCTGGCAAAGAAAGTGACGCATACTACAAACTGACCAACACAAGATCCCAGATTCAAGCCTA
TGTCTTTGATGTGATCAGGGCAAGTGTTCCAAAGCTCAACCTGGATGATGCTTTCGTGCAGAAGAACGATATAGCAAAGGCTGTGGAGGATGAACTTGAG
AAGGCTATGTCCGCATATGGCTTTGAGATCGTGCAGACCCTCATTGTCGACATCGAGCCGGATGCGCATGTCAAGCAGGCGATGAATGAGATCAATGCAG
CTGCAAGGATGAGGGTGGCTGCAAACGAGAAGGCGGAGGCTGAGAAGATTGTCCAGATCAAGCGTGCCGAGGGTGAAGCAGAGGCCAAGTACCTGTCTGG
CCTCGGTATCGCCCGCCAGCGCCAGGCCATTGTGGATGGCCTGAGGGACAGCGTCCTGGGCTTCTCAGTCAACGTGCCTGGCACCACTGCAAAGGATGTG
ATGGACATGGTGCTGATCACCCAGTACTTTGATACTATGAAAGAGATCGGCGCATCCTCCAAGTCCTCGGCGGTGTTCATCCCCCATGGCCCTGGTGCGG
TGCGCGACATCGCCACGCAGATCCGCGATGGTCTTCTTCAAGGCCAGTCTGCCTCTGACAACTAGCAGTTGGCTTTGCCGGCATGAACTTTGAAGCTGGT
GGTGGTTTGTGGTTTGCTAGCTATTGCTTAGAGTACTGTCTAATATGATGCATGCCGTATTATTATGAACTTATATGGAACCATATGTGGATCGTGGCGT
GCCATGCCTTAGGTTGATGTGCGGTAACAAAACCTTTAACCTTGTGGGAATGCAGGATGATATAAGTGTGTTATGAAATGTTGGTGAAAAAAAAAA
page-top