Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17765  (registered. 2012)
Contig Information
Length 1019 bp
Clones alternative view 69 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_r Root 7
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_CA 1
WH_SP 4
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222616957|gb|EEE53089.1|| hypothetical protein OsJ_35850 [Oryza sativa Japonica Group]
Score 455
Evalue 3.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17765
ATGCCGGAGCCCACGTACCTATAGTTTCATAACCTGGGAGGCAGGCGATAACCAGCGATCCGAAACACATCATACACACCGATAACAGCATCGATTTTTT
GCGACCATGTTTATCGGCTATGCGGCCAAATAGCCAACCGCCTATTGGGCGCATCAGGAATCCCGCAGCAAAAACACCTGCTGTTTGTAGTAGTTGAGTC
GTCGTGTTCCCGGACCGACGCTCAAGCCCCCAGACGCCGCAGCGCCGCCACTCCACCCGCAGCGGCAACCATGGCGGTCGGCAAGAACAAGCGCATCTCC
AAGGGGAGGAAGGGTAGCAAAAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCAGCCGCAACGTCG
GCAAGACCCTCGTGTCCAGGACACAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTCGAAGTATCTCTAGCTGATCTTCAGAACGATGA
GGACCAGGCCTACAGGAAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACAAACTTCTGGGGCATGGACTTCACCACTGACAAGCTC
AGGTCTCTTGTGAGGAAGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTTCACCATTGGCTTCACGA
AGAGACGCCCAAACCAGGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGC
AAGCTGTGACTTGAAGGAGCTTGTGAACAAGTTCATCCCTGAGGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAAGCATCTTCCCCCTCCAGAACGTG
TACGTCCGCAAGGTGAAGATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGNNNATGTTGGTGTGAAGCTTG
ACAGGCCTGCTGATGGAGA
page-top