Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17747  (registered. 2012)
Contig Information
Length 944 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115453077|ref|NP_001050139.1|| Os03g0356300 [Oryza sativa (japonica cultivar-group)]
Score 422
Evalue 3.00E-116
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17747
GAAGCGCGCACACCGAGCGAGCGGCGGCAGCACCGAACCCGTCCATGGCGTCCCTCTCCCCCTCCCTCCACCTCCCTTGCAATTCAAGAATTGGCTTCCT
TGGTAAGTCACAAGGCATACTTCTTCGTGTTATCCCTGCTGGCAGAGTTGGTTTCATTAGAAAAACAGTGGAATGCAAGGAATCTAGAATCGGAAAGAAG
CCGATTGAAGTTCCATCAAATGTTACTCTAACACTAGAGGAGCAGTTTGTCAAAGCTAAGGGTCCACTGGGAGAGTTGTCATTAAACTATCCCACCGAAG
TAAAAGTTGTGAAAGAAGAAACTGGCAAATTGAGAGTATTCAAGACTGTGGAAACCAAAAGGGCGAATCAGATGCATGGCCTTTTCAGAACCCTGACGGA
CAACATCATCGTGGGGGTGTCAAAAGGATTTGACAAGAGGCTTCAGTTAGTGGGGGTTGGGTACCGTGCGACGGTGGAGGGCAAAGACCTGGTGATGAAC
CTGGGATTCTCGCACCCAGTCCGGATGGCTGTCCCAGAAGGACTTCAAGTCAAGGTGGAGGAGAATACGAGAATCATCGTGAGTGGGTACGACAAGAGCG
AAATCGGTCAGTTTGCTGCCACCATAAAGAAGTGGAGGCCTCCGGAGCCATACAAGGGGAAGGGTATCCGGTATCAGGACGAGATTGTCAGGAGGAAGGA
GGGCAAAGCTGGGAAGAAGAAATAGAATGCTGTTTATTTGTTTGTTTGCATTTCATACGTACTTTTGTTCTGTTCTCCCTCGGTAATCCGCCATCTTCCG
AGTACTACCATGTTCCTTAGCCCTTGCACACTTTGTAGAGAAAAATGTCACAGTTTACGTCATTGCGATAATTTCTCAGCAGGTGGCGTGGCGGAGCGCC
CATTGCATCTTAAAAATTTTGCCTGGTGGCAAGGAAAAAAAAAA
page-top