Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17733  (registered. 2012)
Contig Information
Length 2495 bp
Clones alternative view 119 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_SH - 3
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 10
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23 17
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 26
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 13
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 12
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|53680379|gb|AAU89392.1|| glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 1202
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17733
TTTTTTTTTTAGAAATCATCCGGTCTCCGATTTCATAAGAACAATAGATACATTAATGCACAATCTTCACTCAAACCTTAGGTCTGCACCACTCTAATGG
CAAGACCAGGTACATCTTATTTCTTATCAGAAACGGCAAGCAGGACAGGACACCATCAACTCTCAATTGCGACACCAGGCGCTGCAACCTCGATCATCCT
CGGCTTCTTGCTGGTTCCTGTCAAGATGGTTGCTGGGAGATGCTCCTGTTCATAGGCCGAGAGATGGACTCCAAGTGCTGCTCTCCCTGAGGGATCCAGG
TTCCCCGACCACTGAGCATCCCACTCTACCGCCTTTGCCGTGCTGCATGCAACGCTTGGCCCGCCTGGCACCGTCAGGATCGCCGAGTTCTGGGGGAAGA
ACCTCTCAAATATCATCCTGTAACAGTAGGCCTCTTTTGTAGTCGGGGTGTTGTGCGGGTAGATGAACTTTGCATTTGACATCATCTTATCGGTCACATT
TGATTCTGCGTGAGCCTTTAGGCCATCAATCCAGCTATAGCCAACACCATCACTGAACTGCTCTTTCTGCCTGTACAGAATGTGCTTTGGCAGGAATGGT
TGCTCCTCGTCATCAAATGCTTTCCTCAGCACCCACTTCTCAATTCTTCCAAGATCAGGTCGGATCATCTTCCACTCAGGATCTATGCTCATTGCCTCAT
TGATAAACTCCTTGTCCAGGAATGGCACACGTGCTTCGAGTCCCCATGCAGATGTTGCCTTGTTGGCCCTCAAGCAATCGTACTGATGCAGAGCTTTGAT
CTTTTGACATGTCTCACGGTGGAGCTCCTCTTTGTTGGGTGCCTTGTGGAAGTAGAGGTACCCTCCGAAAATCTCATCGGAACCCTCACCAGAGATGACC
ATCTTGACGCCAAGTGACTTGATCTTGCGTGACATCAGGAACATTGGCGTGCTTGCCCTGATTGTCGTCACATCATATGTTTCGGTGTGATAAATCACAT
CCTCAATTGCATCAATGCCGTCCTGAACAGTGAAGGTGAACTCATGGTGCATGGTCCCCAGGTAATTGGCTACCTCCTTTGCGGCCTTCAGATCAGGTGA
CCCCTCAAGTCCGACACAAAAAGAATGAAGCTTAGTCCCCCAGCGCTTTGCAGCCTTTGTCCCTGCCAGGTGACGAACTGTAACGGCTGCAACCAATGAT
GAGTCTAGGCCACCAGAGAGTAGAACACCGAATGGAACGTCCGTCATAAGCCTCTTGATGACAGCCTTTTCAAAAGCCTTCCTGAGAGCAAGTGGATCAT
ATGGCACTGAAGGAATGACCTCGGAGAACCAAGGTGGGTTGTACCATCTCTTGAAGCCTCCCTGCTTGCTGGAGTAGAGATGGCCAGGAGGAAAGATCTC
AAAGTGCTCACAATCATCATTCAGGCCCTTCATCTCTGATGATATCCACACCGACCCATCAATTCCCCAGCCAATATACAGGGGTGTGACGCCAATGGCA
TCACGGGCAGCAATGAAGCTGTTGTCGCGTGTGTCGAGCAAGACGAAGGAGAAGACACCATCCAGCATGTCGATGAAGTTCTCCCCGTGCTCCTCGTACA
GGTGCGCGATGACCTCGCAGTCGCTGCCTGTCCTGAACGTGTGGGAGGAGAGCTGCGCCCGGAGCTGTTCATGGTTGTAGATCTCTCCATTCACAGTGAC
GACGATGGACTTGTCCTCGTTGTAGAGGGGCTGGTCGCCAGAGGCAGGGTCGATGATGGCGAGGCGCTGGTGGGAGAGGTAGCAGTCGCCGACCTGGTGC
ATGCCGCTCCAGTCGGGGCCGCGGTGCTTGAGCCTGCGCGAGAGCTCGAGCACGCGCACTCTCTTCCCCTGGGTGTCATCGGCGCAGCCCAGCACCGCCA
GTATGCCGCACATTTTTGCTGGATCGACGGCAACAGTGTGTAGCTAGAAGATCTCTCCCTCGTGCCGAATTCGGCACGAGGGTCGAGAAGCTCAAGCTGA
AGCACAAGGAGCACATCGCCNNNNNNGGCGAGGGCAACGAGCGCCGTCTGACCGGCAAGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGTGTCGC
GAACCGTGGCGCGTCGGTGCGCGTGGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGGCCGGCGTCCAACATGGACCCCTACGTG
GTCACCTCGATGATCGCCGAGACCACCATCCTGTGGAAGCCCTGAAGCCGAGCAGCGCCGATCGCCGTGCGATGATCAGTGGTGGGTTGGGTTTGGTGGT
GGCCATTGGAGGATTTGGACGAAATTCTTCCAAGATATTTCCTTTTCCGTTTGGTTGCATACTACGCGTAGTCCGTTTAGGTAGGTCACATCATCGTCGT
CGTCATCAGGGTGTCTGGTCTCTCTTCTCTCGTCTTTGGGTGGTGGGTGGCAAGAGGCGTGTCAAACACACAGGACTACTATTGATTGTTTTCCC
page-top