Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1772  (registered. 2012)
Contig Information
Length 1293 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 3
Wh_OKCS Seed DPA5 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|30090032|gb|AAO86520.1|| phytochelatin synthetase [Triticum monococcum]
Score 739
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1772
AATTCGGCACGAGGCGCAGACGGAGCGCGTCTCGTCTCGTCGCTGTAAAAACTGGGGAGACGGCCGCGGCCGCACATGCTTTAAGTCCCACTCCCTCCTC
CTCCACCACCACCTGCTCAGTCGCCTCAGATCTCCAGCTCCCCCCTTCATCGGCGGGCGCGGCCGCATTCCTCGCCGTACAGAGCGGAGCGGGGATCGGT
GGGTGGGTAGGTGCGGCTGCGGGAGAGTGTCGGTGGAGGAGTAGCGGGGCAGGAAATGGCGCCGGTTGGTGGCGTCGCCGGGAGCTCCAGATCCGCGGCC
TGCTGCGCCGTGCTGCTCGCGGCGGTGCTCTTCTTCTCCGCACCGGCCACCACAGAGGCTTATGATTCGCTGGATCCAAATGGCAACATCACCATAAAAT
GGGATATTATTTCGTGGACTCCTGATGGTTATGTTGCAACAGTCACAATGTTTAACTACCAGCAGTTCCGACACATACCTGCACCTGGGTGGCAGCTGGG
GTGGTCGTGGGCAAAGAAAGAGGTCATCTGGTCGATGGTGGGGGCTCAGGCTACTGAGCAGGGTGATTGCTCCAAATTCAAGAGTGCCCCTCCCCATTGC
TGCAAGAGAGATCCAACGATTGTCGATCTTCTTCCGGGCACCCCATTCAACCAGCAAATTGCTAATTGTTGCAAGGCAGGAGTTATAAAGACATTTAACC
AGGACCCAGGAAATGCAGCATCCTCCTTCCAGATTAGTGTAGGTCTTGCTGGGACTACCAATAAGACGGTTAAGATGCCGAAAAACTTCACCCTTAGGGC
CCCAGGTCCAGGGTACACATGTGGGCGTGCTCTTGTTGGCAGGCCTACCAAGTATTACTCGTCAGACGGGCGCAGGGTAACCCAAGCTCTCATGTCGTGG
AATGTAACCTGCACATACTCCCAATTCCTTGCTCAGAAGACTCCAACCTGCTGTGTATCTCTCTCATCGTTTTATAATGACACTATTGTGAACTGCCCAA
CGTGCTCTTGCGGCTGCCAAAACAACATTACTCGTCCAGGAAGCTGTGTAAATGACAATTCGCCTTATTTGCAATCTGCCATCAATGGCCCTGGCAAATT
AACCGGCCAGCCTCTTGTCCAATGTACTTCCCACATGTGCCCGATAAGAATCCATTGGCATGTGAAGCTCAACTACAAGGACTACTGGAGAGTGAAAGTC
ACCATCACAAACTTCAACTACCGCATGAATTATACAGACTGGAACATGGNNNNNCAGCATCCTAACTTCGATAATATCACAAAGCTGTTCAGC
page-top