Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17580  (registered. 2012)
Contig Information
Length 867 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125560359|gb|EAZ05807.1|| hypothetical protein OsI_28043 [Oryza sativa Indica Group]
Score 286
Evalue 2.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17580
AGCGTAGCTTTTTTTTTTGGCCAGGAGCATAGCATGTCTTTATTAAACTGGTCTCAACACTCGGAAGTTTTAACTGACACAGTACGGCAGGAGACACACG
CTGTCCAATACATCCATAGTTCATCATAACACGAGTTATTTTCGACAGATTTAAGGACCAATAGGCATCAAGAGCGTCCGAACTTTGTAGTATATGTTCA
TGCCCTCTTGAACAGAACAACTAGGATGACCGCCATGGCAAGAGCCATGAAAGATCCACCAGCCGCCATCTCCGCGAACGAAGGCTTTTTAGATGATGAG
CCCGGTCCAGCCTCGGCTTCTGCCGGGTTGTGGAACAGGTCTTGGAAAAAGTTGGTTATGTTGTCAACCATCTCCATCATCGTCTTCTTCGCATTGTCCA
CAAAGTCCGACAAAGGTGAGGCAGTGGGTAGTGCATATTCCGGGGATGCCTCTTCAAATTTCTCCGGTGACTCTACTGAGTCAGTAGAGTCAGTGCCCTC
AGGAAAAGTATTGACCAGAGTTTGCTGGTGACTCTTGTAAAATTCCATAACCCTCTCATTCTTCAACACCGCGTCCCACACATTTTTATCTGATGCAAGC
GAGGCAACAACACTCTGAGCCTCTGGGCTTGATTTTAACAATGTAAAAGCCTGCACTACATGTCCCGGCATAGCAGGAATTAATGCATCGGCTCCCAGCT
TGCTAAGCTCTTGATCATGTTCCTTAACAACTTCTACTGGAGTCTCTTTAAAATAAACCCTGTCAATAGCTTCCCGGAGCTCGGCGGTGGCCTCCTCGGC
CTCCTCCCGCGACGGCGGGGCGAACACCAGCCTCGGCCCCCCGACCACCGCCACGTCCGCCTCGGAC
page-top