Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig17541  (registered. 2012)
Contig Information
Length 963 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|6958202|gb|AAF32491.1|AF091837_1|AF091837_1 DNA-binding protein [Triticum aestivum]
Score 519
Evalue 2.00E-145
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig17541
TTAAAATTAAACATGTTCCTTATATAGCCTTTTGCCGTGTCAATCGCCACCTGTTTAATTTCTTTACTACTTGTCTCTATAGTATCATGAGAATACATGA
CTGTTCTCATTGTAGTCGCTTATTCCAGCATGTTTGTCTTATTACATGAAAGATAAGATAATTCAATCACTTTTACGCAGCTCCTGGAGTGGCTTGAAGA
TTCCAAAGTAATTGATCTAGGAGAACGTGATTATGCTTCGCGCCTTGATTTGGTAGCTAAAGTTCATGGTGTTTACAAAGCTGAAAAGTATATAGATAGC
ATTCCTATATCTCATAGGGGTGAGATTGTATACAGAACTCTTTTAGCTAATTGTGTGTCTGAAGCAAATGTGAAGAAGTCAGAGGAAGTCTTCAATAAGA
TGAAGGATCTTGGGTTCCCAGTTACAGTATTTGCTATCAATCAGCTTCTGCTACTGTACAAAAGGGTGGACAAGAAGAAGATTGCTGATGTTCTCGCGAA
AATGGAAAAGGAGAATGTGAAACCATCACTCTTCACTTATAAGCTCCTTGTGGACACCAAAGGTGCTATAAGAGATATTGCAGGTATGGAAAAAGTTGTT
GAGTCGATGCAAGCAGAAGGTGTTGAGCCAGATCTTCTGTTTCAAGCAACAATTGCAAAGCACTACATATTTGCTGGTCACCGCGAGAAAGCTGAAGCAA
TTTTGGAGTCAATGGAGGGTGGTGATATCAAAGGAAACCGCAATGCCTGCAAGATTTTATTACCTTTATATGCTTTTCTTGGAAAGAAGGATGATGTTGA
GCGGATGTGGCAGGTTTGCGAGGCCAATCCTCGTCTAGATGAGTGCTTGTCTGCTATAGAATCTTTTGGTAGGCTTGGAGACGTTGAACGGGCGGAGAAA
GTCTTTGAGGATATGTTTGCGACATGGAAAACACTCTCCTCCAAATTCTACAATGCTTTGATG
page-top